[Skip to Content]
Access to paid content on this site is currently suspended due to excessive activity being detected from your IP address 54.205.176.107. Please contact the publisher to request reinstatement.
[Skip to Content Landing]
Download PDF
Figure 1. Methylprednisolone (MP) induced increased expression of several genes in cultured normal human keratinocytes. A and B, Real-time polymerase chain reaction analysis of messenger RNA (mRNA) showed up to 5-fold increased S100A8 expression (A) and up to 2-fold S100A9 expression (B) after 12 hours of incubation in different MP concentrations. C and D, In addition, MP upregulated the mRNA levels of RAGE by 3-fold (C) and NFκB up to 14-fold (D) in a dose-dependent manner. The graphs show mean (SD) relative expression. * P < .05; † P < .01; ‡ P < .001.

Figure 1. Methylprednisolone (MP) induced increased expression of several genes in cultured normal human keratinocytes. A and B, Real-time polymerase chain reaction analysis of messenger RNA (mRNA) showed up to 5-fold increased S100A8 expression (A) and up to 2-fold S100A9 expression (B) after 12 hours of incubation in different MP concentrations. C and D, In addition, MP upregulated the mRNA levels of RAGE by 3-fold (C) and NFκB up to 14-fold (D) in a dose-dependent manner. The graphs show mean (SD) relative expression. * P < .05; † P < .01; ‡ P < .001.

Figure 2. Cyclosporin A (CsA) in various concentrations was applied to cultured normal human keratinocytes. A-D, Concentrations of CsA from 1μM to 10μM were applied to human primary keratinocytes for 12 hours, and thereafter, messenger RNA (mRNA) extraction and real-time polymerase chain reaction analysis was performed. After 12 hours of CsA incubation S100A8 (A) and S100A9 (B) mRNA levels were increased. The expression of RAGE mRNA was slightly but significantly decreased (C), while the expression of NFκB remained unchanged (D). The graphs show mean (SD) relative expression. * P < .05; † P < .01.

Figure 2. Cyclosporin A (CsA) in various concentrations was applied to cultured normal human keratinocytes. A-D, Concentrations of CsA from 1μM to 10μM were applied to human primary keratinocytes for 12 hours, and thereafter, messenger RNA (mRNA) extraction and real-time polymerase chain reaction analysis was performed. After 12 hours of CsA incubation S100A8 (A) and S100A9 (B) mRNA levels were increased. The expression of RAGE mRNA was slightly but significantly decreased (C), while the expression of NFκB remained unchanged (D). The graphs show mean (SD) relative expression. * P < .05; † P < .01.

1.
Hofbauer GF, Bouwes Bavinck JN, Euvrard S. Organ transplantation and skin cancer: basic problems and new perspectives.  Exp Dermatol. 2010;19(6):473-482PubMedArticle
2.
Gebhardt C, Riehl A, Durchdewald M,  et al.  RAGE signaling sustains inflammation and promotes tumor development.  J Exp Med. 2008;205(2):275-285PubMedArticle
3.
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method.  Nat Protoc. 2008;3(6):1101-1108PubMedArticle
4.
Mühleisen B, Petrov I, Gächter T,  et al.  Progression of cutaneous squamous cell carcinoma in immunosuppressed patients is associated with reduced CD123+ and FOXP3+ cells in the perineoplastic inflammatory infiltrate.  Histopathology. 2009;55(1):67-76PubMedArticle
5.
Salasche SJ. Epidemiology of actinic keratoses and squamous cell carcinoma.  J Am Acad Dermatol. 2000;42(1, pt 2):4-7PubMedArticle
Research Letter
February 2013

Influence of Cyclosporin and Prednisolone on RAGE, S100A8/A9, and NFκB Expression in Human Keratinocytes

Author Affiliations

Author Affiliations: Department of Dermatology, University Hospital Zürich, Zurich, Switzerland.

JAMA Dermatol. 2013;149(2):236-237. doi:10.1001/jamadermatol.2013.836

Squamous cell carcinoma (SCC) is the most common neoplasm among immunosuppressed patients.1 The immune system plays a prominent role in tumor development. The role of RAGE and its extracellular heterodimeric ligand S100A8/A9 in the development of SCC has recently been suggested.2 Because this pathway acts through the transcription factor NFκB and thus regulates inflammatory responses, its function may be of particular interest with respect to the development of skin cancer in immunosuppressed patients. Therefore, we aimed to analyze the impact of the most commonly used immunosuppressive agents (cyclosporin A and prednisolone) on RAGE, S100A8/A9, and NFkB expression.

Methods

After study approval from the institutional review board, human keratinocytes were obtained from normal skin of healthy volunteers. For the experiments, the cells were incubated with either cyclosporin A (CsA) (Novartis Pharma, Switzerland) or methylprednisolone (MP) (Sigma Aldrich, Switzerland) at different concentrations for 12 hours. The control cells were treated with vehicles only, ethanol and dimethyl sulfoxide for CsA and MP, respectively. After the incubation period, the cells were homogenized with TRIzol Reagent (Invitrogen) for subsequent messenger RNA (mRNA) extraction and quantitative reverse transcriptase–polymerase chain reaction analysis. Specific primers were used for S100A8 (primer forward, GGGAATTTCCATGCCGTCT; primer reverse, CCTTTTTCCTGATATACTGAGGAC), S100A9 (primer forward, CTGTGTGGCTCCTCGGCT; primer reverse, GCGTTCCAGCTGCGACAT), RAGE (Hs_AGER_1_SG) (Quantitect Primer assay; Qiagen AG), and NFκB (NF-κB-p65) (primer forward, CCCCACGAGCTTGTAGGAAAG; primer reverse, CCAGGTTCTGGAAACTGTGGAT). Samples were processed in triplicate with 36B4 (primer forward, GCAATGTTGCCAGTGTCTGT; primer reverse, GCCTTGACCTTTTCAGCAAG) as the internal standard. Expression of mRNA was calculated by the ΔΔ threshold cycle.3 Significance was set at P < .05 (analysis of variance followed by Dunnett post hoc test). All experiments were performed 2 times independently.

Results

Methylprednisolone induced the expression of S100A8, S100A9, NFκB, and RAGE in human primary keratinocytes. Normal human keratinocytes cultured for 12 hours in the presence of different concentrations of MP (ranging from 0.1mM to 3.0mM), a potent anti-inflammatory and immunosuppressive drug, significantly increased the expression of the S100A8 and S100A9 mRNA, and the induction was more pronounced for the S100A8 gene (Figure 1). At the concentrations tested, MP also significantly increased the mRNA expression of RAGE and its putative downstream target, NFkB.

Cyclosporin treatment increased mRNA levels of S100A8 and S100A9. Analysis of the influence of CsA on the S100A8/A9 -RAGE loop members in vitro demonstrated that this commonly used immunosuppressive drug is an inducer of S100A8 and S100A9 mRNA. Normal human keratinocytes exposed to relatively low concentrations of CsA, ranging from 1μM to 10μM, responded by increased expression of the heterodimer S100A8/A9 (Figure 2). Only the highest CsA concentration slightly but significantly decreased the RAGE mRNA level however, most likely reflecting the cytotoxic effect of this concentration. Cyclosporin A had no influence on mRNA expression for the RelA subunit of the NFκB complex.

Comment

Multiple clinical phenomena suggest a close relationship between inflammation and SCC development.1 It has been shown that inflammation is present at low levels in the microenvironment of in situ and invasive SCC of the skin.4 The difference between this kind of chronic inflammation and acute inflammation lies probably in the orchestration of an effective antitumor immune response. Acute inflammation if strong enough is therapeutically used to treat SCC of the skin,5 while chronic inflammation can be observed in SCC of the skin where a lack of antitumor defense may allow for tumor formation.

Drug-induced immunosuppression—while profoundly compromising the cytotoxic response of the adaptive immune system, as in organ transplant recipient (OTR) rejection—apparently impairs the inflammatory environment of SCC to a lesser degree. While tumor defense such as a cytotoxic response of the adaptive immune system seems impaired in SCC in OTRs, a persistent inflammatory feed-forward loop via RAGE may contribute to uncontrolled SCC formation in OTRs.

Our results demonstrate that the immunosuppressive agents MP and, to a lesser degree, CsA are able to induce the expression of S100A8/A9 in keratinocytes. Promotion of SCC formation through the inflammatory mediators S100A8/A9 and RAGE may thus not be dependent on the immune system (inflammatory infiltrate) alone, but keratinocytes in their own right may contribute to the process by the S100A8/A9-RAGE feed-forward cycle. The influence of immunosuppressive drugs on S100A8/A9-RAGE mRNA expression may also suggest a role of these proteins in early-stage SCC development in immunosuppressed patients, facilitating the clinically observed increase of SCCs in these patients.

Back to top
Article Information

Correspondence: Dr Hofbauer, Department of Dermatology, University Hospital Zurich, Gloriastrasse 31, 8091 Zürich, Switzerland (hofbauer@usz.ch).

Accepted for Publication: August 18, 2012.

Author Contributions: Dr Hofbauer had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Djerbi, French, and Hofbauer. Acquisition of data: Djerbi, Reinhardt, Hafner, and Läuchli. Analysis and interpretation of data: Djerbi, Dziunycz, Reinhardt, Iotzova-Weiss, and Hofbauer. Drafting of the manuscript: Djerbi, Dziunycz, and Hofbauer. Critical revision of the manuscript for important intellectual content: Reinhardt, Iotzova-Weiss, Hafner, Läuchli, French, and Hofbauer. Statistical analysis: Dziunycz. Obtained funding: Hofbauer. Administrative, technical, and material support: Djerbi, Dziunycz, Hafner, Läuchli, and Hofbauer. Study supervision: Dziunycz, Iotzova-Weiss, Läuchli, French, and Hofbauer.

Conflict of Interest Disclosures: None reported.

Funding/Support: Work for this article was supported by the Olga-Mayenfisch Foundation, the René-Touraine Foundation, and the European Skin Research Foundation (Dr Dziunycz); and by the EMDO Foundation, the Baugarten Foundation, and the Hartmann-Müller Foundation (Dr Iotzova-Weiss).

Role of the Sponsors: The sponsors had no role in the design and conduct of the study; in the collection, analysis, and interpretation of data; or in the preparation, review, or approval of the manuscript.

References
1.
Hofbauer GF, Bouwes Bavinck JN, Euvrard S. Organ transplantation and skin cancer: basic problems and new perspectives.  Exp Dermatol. 2010;19(6):473-482PubMedArticle
2.
Gebhardt C, Riehl A, Durchdewald M,  et al.  RAGE signaling sustains inflammation and promotes tumor development.  J Exp Med. 2008;205(2):275-285PubMedArticle
3.
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method.  Nat Protoc. 2008;3(6):1101-1108PubMedArticle
4.
Mühleisen B, Petrov I, Gächter T,  et al.  Progression of cutaneous squamous cell carcinoma in immunosuppressed patients is associated with reduced CD123+ and FOXP3+ cells in the perineoplastic inflammatory infiltrate.  Histopathology. 2009;55(1):67-76PubMedArticle
5.
Salasche SJ. Epidemiology of actinic keratoses and squamous cell carcinoma.  J Am Acad Dermatol. 2000;42(1, pt 2):4-7PubMedArticle
×