[Skip to Content]
Access to paid content on this site is currently suspended due to excessive activity being detected from your IP address 54.163.129.96. Please contact the publisher to request reinstatement.
[Skip to Content Landing]
Views 2,106
Citations 0
Case Report/Case Series
December 2015

Effect of Quadrivalent Human Papillomavirus Vaccination on Oral Squamous Cell Papillomas

Author Affiliations
  • 1Department of Dermatology, University of Texas Southwestern Medical Center, Dallas
  • 2Department of Dermatology, University of Virginia Health System, Charlottesville
  • 3Department of Dermatology, University of Pennsylvania Health System, Philadelphia
  • 4Department of Pathology, Pennsylvania Hospital, Philadelphia
  • 5DDL Diagnostic Laboratory BV, Rijswijk, the Netherlands
  • 6Department of Dermatology, Leiden University Medical Center, Leiden, the Netherlands
  • 7Division of Infectious Diseases, Pennsylvania Hospital, University of Pennsylvania Health System, Philadelphia
JAMA Dermatol. 2015;151(12):1359-1363. doi:10.1001/jamadermatol.2015.2805
Abstract

Importance  Cutaneous verruca vulgaris lesions (warts) and oral squamous cell papillomas are common lesions caused by human papillomavirus (HPV). Multiple reports have described cases of wart resolution following quadrivalent HPV vaccination. We report the case of a patient with chronic oral papillomas with resolution after quadrivalent HPV vaccination and perform a review of the literature.

Observations  An immunocompetent man in his 60s presented with chronic verrucous papules on the lips, tongue, and buccal mucosa refractory to multiple excisions. Biopsy showed squamous cell papilloma, and DNA sequencing revealed HPV-32. He received the quadrivalent HPV vaccine resulting in clearance of all lesions after 3 months. We found 8 reported cases of disseminated, recurrent warts with resolution after quadrivalent HPV vaccination. Improvement was seen within 4 weeks of vaccination, and resolution after 3 to 8 months.

Conclusions and Relevance  We report the case of recurrent oral papillomas caused by HPV-32 with complete resolution after quadrivalent HPV vaccination and reviewed reports of resolution of recalcitrant and disseminated warts after vaccination. Production of cross-protective immunoglobulins and cytotoxic T cells is a possible mechanism. There remains a critical need for randomized clinical trials to assess efficacy of quadrivalent HPV vaccination for treatment of oral squamous papillomas and cutaneous verruca vulgaris.

Introduction

Human papillomavirus (HPV) is the underlying cause of mucocutaneous verruca vulgaris and squamous cell papillomas, also known as oral warts. Current treatments for oral verrucae include topical salicylic acid, imiquimod, electrocoagulation, cryotherapy, intralesional Candida antigen and bleomycin, laser therapy, and oral cimetidine, all showing modest or undetermined efficacy in clinical trials.1 Use of topical and destructive treatments is particularly challenging in patients with disseminated disease. The quadrivalent HPV vaccine has been approved by the US Food and Drug Administration for prevention of cervical cancer and genital warts. It was developed using the viruslike peptide of the L1 protein in HPV types 6, 11, 16, and 18.2 Combined, HPV-16 and HPV-18 are responsible for more than 70% of cervical cancer, while HPV-6 and HPV-11 cause 90% of genital warts.

Even though the vaccine was developed as a preventive measure for cervical cancers and genital warts, there have been a number of reports of complete resolution of recalcitrant and disseminated verruca vulgaris in patients after quadrivalent HPV vaccination.37 Herein, we report a case of a healthy man in his 60s who had complete clearance of recurrent warts on the lips, tongue, and buccal mucosae within 3 months of receiving the quadrivalent HPV vaccine. Laser-capture microdissection followed by amplification and sequencing of HPV DNA from lesional tissue revealed the presence of HPV-32. We also performed a literature review of cases reporting the presence or absence of a therapeutic response of verruca vulgaris to quadrivalent HPV vaccine.

Report of a Case
Clinical and Pathologic Characteristics

A healthy, immunocompetent white man in his 60s presented with recurrent mucocutaneous lesions on his lips, tongue, and buccal mucosae. He first noted the appearance of the lesions 18 months prior to presentation and had undergone multiple surgical excisions of the lesions by an otorhinolaryngologist with subsequent recurrences. His sexual history was significant for oral sex with multiple male partners. He reported smoking one-half pack of cigarettes a day and denied any history of quadrivalent human papillomavirus vaccination.

Examination findings were notable for multiple tan to pink verrucous papules on the lips, tongue, and bilateral buccal mucosae (Figure 1A). The remainder of his examination findings, including complete skin, rectal, and genital examinations, were unremarkable. Hepatitis B and C results were negative. He had undergone a human immunodeficiency virus (HIV) test 1 year prior to presentation, with negative results.

Figure 1.
Clinical Views of Lesions on Left Buccal Mucosa and Tongue Before and After Quadrivalent HPV Vaccination
Clinical Views of Lesions on Left Buccal Mucosa and Tongue Before and After Quadrivalent HPV Vaccination

HPV indicates human papillomavirus. A, Verrucous oral squamous cell papilloma papules, coalescing in some areas, on the left buccal mucosa before quadrivalent HPV vaccination. B, Complete resolution of lesions on the left buccal mucosa after vaccination.

An excisional biopsy was performed on a lesion on the left buccal mucosa. Formalin-fixed tissue was prepared with standard hematoxylin-eosin stains. Microscopic examination revealed moderately keratinized epithelial fronds supported on connective tissue containing dilated capillaries. Scattered cells with crumpled, darkly stained nuclei with perinuclear halos were identified within the epithelium, consistent with koilocytes (Figure 2). Multiple lymphocytes and neutrophils were also present, indicative of acute and chronic inflammation. A diagnosis of squamous cell papilloma with HPV viral effect was made.

Figure 2.
Histopathologic Findings of Excisional Biopsy Specimens From Oral Squamous Cell Papillomas on the Left Buccal Mucosa (Hematoxylin-Eosin)
Histopathologic Findings of Excisional Biopsy Specimens From Oral Squamous Cell Papillomas on the Left Buccal Mucosa (Hematoxylin-Eosin)

A, Moderately keratinized exophytic epithelial fronds supported on connective tissue, consistent with mucosal squamous cell papilloma (original magnification ×100). B, Dark nuclei with perinuclear haloes representing koilocytes are human papillomavirus (HPV)-infected cells; infiltrating lymphocytes and neutrophils are also seen (original magnification ×200). C, Three discrete areas of cells (outlined areas; original magnification not reported) were excised from the slide by laser-capture microdissection (LCM) and analyzed for HPV type as described in the HPV Typing subsection, with results summarized herein.

Within 4 weeks after receiving the first dose of quadrivalent HPV vaccine, the patient reported marked improvement of the papillomas. He subsequently received the second and third injections of HPV quadrivalent vaccine at 2 and 6 months, respectively. At 3 months’ follow-up, 1 month after the second dose of the vaccine, he had complete resolution of all papillomas. At 6 months’ follow-up after initial presentation, the patient still had complete resolution of all mucocutaneous papillomas with no recurrence (Figure 1B). The patient reported no recurrence of lesions at 18 months, 1 year after receiving the last dose of vaccination.

HPV Typing

To determine the HPV type, we prepared the DNA using the QiaAmp DNA FFPE Tissue (Qiagen). The DNA was then analyzed for the presence of 23 skin wart–associated HPV types with the HSL-PCR/MPG assay, as described by the manufacturer (Labo Bio-Medical Products BV). This assay includes a polymerase chain reaction (PCR) with 13 forward and 14 reverse primers generating a biotinylated amplimer of 76 to 84 base pairs (bp) from the HPV-L1 region.8 Genotyping was performed with bead-based xMAP suspension array technology, allowing simultaneous identification of HPV types from the α-(HPV-2, -3, -7, -10, -27, -28, -29, -40, -43, -57, -77, -91, and -94), γ-(HPV-4, -65, -95, -48, -50, -60, and -88), μ-(HPV-1 and -63) and ν-genus (HPV-41). None of the targeted HPV types were detected.

As a second step, 3 discrete areas of lesional mucosa were excised from the hematoxylin-eosin–stained slides by laser-capture microdissection with the PALM MicroBeam UV laser microdissection system (Zeiss) followed by DNA isolation with Proteinase K solution (Qiagen). The SPF10-PCR DEIA/LiPA25 system, version 1, (Labo Bio-Medical Products BV), was applied to detect a wide spectrum of genital and skin HPV types. This PCR approach amplifies a 65-bp fragment of the HPV-L1 region followed by DNA Enzyme Immuno Assay (DEIA) to detect a large spectrum of at least 68 HPV types with a general probe cocktail. The DEIA-positive samples were genotyped by the LiPA25 reverse-hybridization line probe assay, which allows simultaneous identification of 25 specific mucosal HPV genotypes: 6, 11, 16, 18, 31, 33, 34, 35, 39, 40, 42, 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 66, 68/73, 70, and 74. All 3 laser-capture microdissection areas were SPF10 DEIA positive but LiPA25 negative, and these were further characterized by sequencing analysis. The PCR products were reamplified with SPF10 primers with SP6 and T7 linker sequences to generate a 105-bp reamplification product. Elongation of the PCR product from 65 bp to 105 bp was needed to generate high-quality DNA sequences. The SP6 and T7 primers were used for bidirectional sequence analysis, revealing the presence of sequences homologous with HPV-32. All 3 of the 22-bp inner-primer sequences revealed exactly the same nucleotide sequence. This sequence was 100% homologous to HPV-32 (TATATGTTGGGGTAATCAAGTG).

Review of the Literature

A literature review of cases reporting the absence or presence of a therapeutic response to quadrivalent HPV vaccine in patients with cutaneous warts and/or oral squamous cell papillomas revealed 8 reported cases of verruca vulgaris resolution with HPV quadrivalent vaccine (Table). In the first case,3 a 31-year old man with numerous warts on his hands, knees, and chin was previously treated unsuccessfully with podophyllin, salicylic acid (25% and 40%), imiquimod, cryotherapy, and oral cimetidine. Four weeks after receiving his first dose of quadrivalent HPV vaccine, he experienced significant improvement of his warts and had complete resolution of all his warts in 8 months. He remained free of warts at his 18-month follow up visit.3

Table.  
Resolution of Verruca Vulgaris and Oral Squamous Cell Papillomas After Quadrivalent HPV Vaccination
Resolution of Verruca Vulgaris and Oral Squamous Cell Papillomas After Quadrivalent HPV Vaccination

Four other patients with recalcitrant verruca vulgaris4 were treated with quadrivalent HPV vaccine resulting in complete resolution of lesions. Therapeutic response was observed as early as 2 to 3 weeks after the first round of vaccination. Two of the 4 patients had been previously treated with cryotherapy and salicylic acid without response. Three immunized patients were still clear of disease at 6-month follow-up. The fourth patient did not follow the typical vaccine schedule but had complete resolution at 14 months. All 4 patients remained disease free after 12 to 24 months of follow up.4

One of the most striking cases was that of a 41-year-old woman with WILD syndrome (disseminated warts, cell-mediated immunodeficiency, primary lymphedema, and anogenital dysplasia) and persistent and disseminated verruca vulgaris who received no treatment for 10 years.5 After receiving the quadrivalent HPV vaccine, she experienced significant therapeutic response at 4 weeks with substantial clearing of all warts by 6 months. The HPV types present in this patient were HPV-57 in the skin warts and HPV-6, -51, -52, -61, and -84 in the anogenital lesions.

A 59-year-old woman with large, multiple plantar warts resistant to many modalities of treatment experienced complete resolution of her warts within 8 months after quadrivalent HPV vaccination.6 A 41-year-old woman with B-cell lymphocytic lymphoma and breast cancer presented with numerous warts forming large plaques on the forearms, dorsal hands, and fingers. She received the quadrivalent HPV vaccine and experienced complete resolution of all lesions within 3 months after the third dose of the vaccine.7

Discussion

The findings in the present case and in the 8 cases reported in the literature indicate that the first signs of clinical improvement of warts occurs around 4 weeks after the first quadrivalent HPV vaccine dose, while complete resolution usually occurs after 6 to 8 months. Following the first dose, the patients described herein remained disease free for up to 2 years. However, not all cases showed a relationship between quadrivalent HPV vaccination and wart resolution. A case series of 6 immunocompetent patients with condyloma acuminata did not show resolution of disease following quadrivalent HPV vaccination.9

In a study of an immunocompetent population, HPV types 1, 2, 4, 27, and 57 were determined to be the most common HPV types present in cutaneous warts.10 Human papillomavirus types 2, 4, 6, 7, and 11 were reported to be common in oral squamous cell papillomas and verruca vulgaris, while HPV-13 and -32 were commonly found in Heck disease.11 Cell-mediated immunity and cytotoxic T lymphocytes play an important role in the body’s ability to clear HPV-infected cells.2 Prevalence of verruca vulgaris in organ transplant patients and those with HIV is significantly higher than in the general population owing to a deficient cell-mediated immune system.2 In the case of HPV vaccination, protection is also achieved via the induction of humoral immune responses such as the production of HPV antibodies. Interestingly, it has been shown that the quadrivalent HPV vaccine can induce production of anti-HPV cytotoxic T lymphocytes and immunoglobulins against both HPV-16 and nonvaccine HPV types, even in immunosuppressed patients.12

Another interesting phenomenon is cross-protection in which vaccination against a particular HPV type confers protection against other HPV types, likely owing to homologous sequences.3 Cross-protection has been reported in HPV infection prevention, in which HPV-16 and -18 vaccination had modest efficacy in preventing infection with low-risk HPV types 6, 11, and 74.13 In addition, cross-protection from HPV types 31, 33, 45, and 51 was observed in women who received HPV-16 and -18 vaccinations.14 In our study, the presence of HPV-32 within the lesional mucosa using laser microdissection PCR suggests the possibility of cross-protection against nonvaccine HPV types after administration of the quadrivalent vaccine.

Human papillomavirus can evade immune responses, in particular because the production of infectious virions is mostly restricted to the upper layers of the epithelium, which are relatively immune privileged compared with the basal epithelium.2 The possible mechanism for resolution of warts after quadrivalent HPV vaccination includes presentation of the L1 protein antigen, which is delivered systemically, by antigen-presenting cells to T and B cells in lymph nodes, leading to production of HPV-specific CD4 helper T cells, cytotoxic T cells, and immunoglobulin-producing B cells. Other examples of immunotherapy for treatment of warts include intralesional injection of Candida antigen. Recently, intralesional Mycobacterium w vaccine showed 67% clearance rates of anogenital warts and reduction in mean HPV viral loads.15

Among the reported cases, the present case was the only one to involve a patient with chronic oral warts who responded to quadrivalent HPV vaccination. This was also the only case with HPV-32 found in lesional skin. It is interesting to note that HPV type 32 is also associated with Heck disease. Based on the published DNA sequences of the L1 protein, HPV-32 has approximately 72% homology with HPV-16, which may contribute to the mechanism of cross-protection (UniProt; http://www.uniprot.org).

Conclusions

Herein we report the case of a patient with chronic oral squamous cell papillomas caused by HPV-32 that completely resolved after quadrivalent HPV vaccination. The literature review revealed 8 cases in which patients with recalcitrant verruca vulgaris experienced marked therapeutic response after quadrivalent HPV vaccination. Possible mechanisms include cross-protective cytotoxic T cells and immunoglobulins. Based on the timeframe of all nine cases, when a response is observed after HPV vaccination, it typically starts around 4 weeks after the first immunization dose, and complete resolution occurs at around 6 to 8 months. Randomized clinical trials are needed to assess the efficacy quadrivalent HPV vaccine in the treatment of cutaneous and mucosal warts, especially in cases of recalcitrant or disseminated lesions. In these future trials, HPV types could be determined, and the production of specific antibodies and T cells against HPV types in cutaneous and mucosal warts could be monitored to delineate underlying mechanisms of therapeutic response.

Back to top
Article Information

Accepted for Publication: March 25, 2015.

Corresponding Author: John J. Stern, MD, Division of Infectious Diseases, Pennsylvania Hospital, University of Pennsylvania Health System, 301 S 8th St, Philadelphia, PA 19107 (john.stern@uphs.upenn.edu).

Published Online: September 2, 2015. doi:10.1001/jamadermatol.2015.2805.

Author Contributions: Drs Cyrus and Stern had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis.

Study concept and design: Cyrus, Blechman, Leboeuf, Stern.

Acquisition, analysis, or interpretation of data: Cyrus, Blechman, Leboeuf, Belyaeva, de Koning, Quint, Stern.

Drafting of the manuscript: Cyrus, Blechman, Leboeuf, Belyaeva, de Koning, Stern.

Critical revision of the manuscript for important intellectual content: Cyrus, Blechman, Leboeuf, de Koning, Quint, Stern.

Obtained funding: Cyrus, Belyaeva.

Administrative, technical, or material support: Cyrus, Blechman, Leboeuf, de Koning, Quint.

Study supervision: Stern.

HPV analyses: de Koning.

Conflict of Interest Disclosures: None reported.

Funding/Support: This study was supported in part by the Pennsylvania Hospital Infectious Disease Research Fund (University of Pennsylvania Health System); HPV typing was funded by this sponsor.

Role of the Funder/Sponsor: The funding institution contributed to the collection, management, analysis, and interpretation of data; however, it had no role in the design and conduct of the study; preparation, review, or approval of the manuscript; and decision to submit the manuscript for publication.

Additional Contributions: We are indebted to Jason Newman, MD; he received no compensation for his contributions. We also thank the patient for granting permission to publish these images and information.

References
1.
Kwok  CS, Gibbs  S, Bennett  C, Holland  R, Abbott  R.  Topical treatments for cutaneous warts. Cochrane Database Syst Rev. 2012;9:CD001781.
PubMed
2.
Stanley  M.  Immune responses to human papillomavirus. vaccine. 2006;24(suppl 1):S16-S22.
PubMedArticle
3.
Venugopal  SS, Murrell  DF.  Recalcitrant cutaneous warts treated with recombinant quadrivalent human papillomavirus vaccine (types 6, 11, 16, and 18) in a developmentally delayed, 31-year-old white man. Arch Dermatol. 2010;146(5):475-477.
PubMedArticle
4.
Daniel  BS, Murrell  DF.  Complete resolution of chronic multiple verruca vulgaris treated with quadrivalent human papillomavirus vaccine. JAMA Dermatol. 2013;149(3):370-372.
PubMedArticle
5.
Kreuter  A, Waterboer  T, Wieland  U.  Regression of cutaneous warts in a patient with WILD syndrome following recombinant quadrivalent human papillomavirus vaccination. Arch Dermatol. 2010;146(10):1196-1197.
PubMedArticle
6.
Landis  MN, Lookingbill  DP, Sluzevich  JC.  Recalcitrant plantar warts treated with recombinant quadrivalent human papillomavirus vaccine. J Am Acad Dermatol. 2012;67(2):e73-e74.
PubMedArticle
7.
Silling  S, Wieland  U, Werner  M, Pfister  H, Potthoff  A, Kreuter  A.  Resolution of novel human papillomavirus-induced warts after HPV vaccination. Emerg Infect Dis. 2014;20(1):142-145.
PubMedArticle
8.
de Koning  MN, ter Schegget  J, Eekhof  JA,  et al.  Evaluation of a novel broad-spectrum PCR-multiplex genotyping assay for identification of cutaneous wart-associated human papillomavirus types. J Clin Microbiol. 2010;48(5):1706-1711.
PubMedArticle
9.
Kreuter  A, Wieland  U.  Lack of efficacy in treating condyloma acuminata and preventing recurrences with the recombinant quadrivalent human papillomavirus vaccine in a case series of immunocompetent patients. J Am Acad Dermatol. 2013;68(1):179-180.
PubMedArticle
10.
Bruggink  SC, de Koning  MN, Gussekloo  J,  et al.  Cutaneous wart-associated HPV types: prevalence and relation with patient characteristics. J Clin Virol. 2012;55(3):250-255.
PubMedArticle
11.
Chang  F, Syrjänen  S, Kellokoski  J, Syrjänen  K.  Human papillomavirus (HPV) infections and their associations with oral disease. J Oral Pathol Med. 1991;20(7):305-317.
PubMedArticle
12.
Weinberg  A, Song  LY, Saah  A,  et al; IMPAACT/PACTG P1047 Team.  Humoral, mucosal, and cell-mediated immunity against vaccine and nonvaccine genotypes after administration of quadrivalent human papillomavirus vaccine to HIV-infected children. J Infect Dis. 2012;206(8):1309-1318.
PubMedArticle
13.
Szarewski  A, Skinner  SR, Garland  SM,  et al.  Efficacy of the HPV-16/18 AS04-adjuvanted vaccine against low-risk HPV types (PATRICIA randomized trial): an unexpected observation. J Infect Dis. 2013;208(9):1391-1396.
PubMedArticle
14.
Wheeler  CM, Castellsagué  X, Garland  SM,  et al; HPV PATRICIA Study Group.  Cross-protective efficacy of HPV-16/18 AS04-adjuvanted vaccine against cervical infection and precancer caused by non-vaccine oncogenic HPV types: 4-year end-of-study analysis of the randomised, double-blind PATRICIA trial. Lancet Oncol. 2012;13(1):100-110.
PubMedArticle
15.
Kumar  P, Dar  L, Saldiwal  S,  et al.  Intralesional injection of Mycobacterium w vaccine vs imiquimod, 5%, cream in patients with anogenital warts: a randomized clinical trial. JAMA Dermatol. 2014;150(10):1072-1078.
PubMedArticle
×