[Skip to Content]
Access to paid content on this site is currently suspended due to excessive activity being detected from your IP address 54.147.196.37. Please contact the publisher to request reinstatement.
[Skip to Content Landing]
Citations 0
Correspondence
April 2003

Human Herpesvirus 6 in Serum and Spinal Fluid of Patients With Multiple Sclerosis?

Arch Neurol. 2003;60(4):639. doi:10.1001/archneur.60.4.639-a

In the June issue of the ARCHIVES, Alvarez-Lafuente et al1 reported an active human herpesvirus 6 (HHV-6) variant A infection in a small group of patients with multiple sclerosis (MS). This will certainly stimulate the ongoing debate concerning the role of HHV-6 in the pathogenesis of MS.25 Similarly, we examined the serum and cerebrospinal fluid (CSF) of 27 patients with MS for HHV-6 DNA using a nested polymerase chain reaction (PCR) and measured anti–HHV-6 IgG and IgM in the serum with an immunofluorescence assay. All patients with MS, including 9 who were recently diagnosed (15 women, 12 men; median age, 34 years; range, 19-52 years), had multiple MS lesions on magnetic resonance imaging scans, oligoclonal IgG in the CSF, and delayed evoked potentials. The course was relapsing-remitting in all but 1 patient. Primers used in the nested PCR allow the amplification of a specific DNA fragment, 709 base pairs in size, from the glycoprotein gene U47 in HHV-6 variants A and B (outer primers: variable glycoprotein–primer 1, 5′GTGGCGTTAAGACGGATTGT3′ and variable glycoprotein–primer 1 reverse, 5′ATCTATCCCTCGACTGCTTC3′; inner primers: variable glycoprotein–primer 2, 5′GTCGAGGAAAATCTGAACGTTTAAC3′ and variable glycoprotein–primer 2 reverse, 5′ACTCAAATTTTAACTAACGTTTTCTCTTGG3′). The detection limit determined by spiking a serum sample with graded amounts of a plasmid containing the U47 gene was 10 copies per 150 µL, corresponding to 2 copies per PCR. No cross-reactivity was observed with other herpes viruses. DNA was extracted using a standard protocol (proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation). In essence, the PCR results from all of our serum and CSF samples were negative. Moreover, none of the 27 patients with MS had HHV-6–specific IgM, whereas 19 of 27 serum samples were positive for HHV-6 IgG.

First Page Preview View Large
First page PDF preview
First page PDF preview
×