[Skip to Content]
Access to paid content on this site is currently suspended due to excessive activity being detected from your IP address 54.163.129.96. Please contact the publisher to request reinstatement.
Sign In
Individual Sign In
Create an Account
Institutional Sign In
OpenAthens Shibboleth
[Skip to Content Landing]
Download PDF
A, Allelic variants of CST3. There are 3 polymorphic Ksp I restriction sites (X) within 230 base pairs of the 5′ flanking region and exon 1; they are in strong linkage disequilibrium. These 3 polymorphisms in the CST3 gene result in only 2 commonly found human haplotypes, called CST3 A (nucleotides G, A, and G at positions −157, −72 and +73) and CST3 B (C, C, and A at these positions), respectively. B, Amino acid sequence of the cystatin C signal peptide. Alanine to threonine variation at the −2 position residue of signal peptidase cleavage.

A, Allelic variants of CST3. There are 3 polymorphic Ksp I restriction sites (X) within 230 base pairs of the 5′ flanking region and exon 1; they are in strong linkage disequilibrium. These 3 polymorphisms in the CST3 gene result in only 2 commonly found human haplotypes, called CST3 A (nucleotides G, A, and G at positions −157, −72 and +73) and CST3 B (C, C, and A at these positions), respectively. B, Amino acid sequence of the cystatin C signal peptide. Alanine to threonine variation at the −2 position residue of signal peptidase cleavage.

Table 1. 
CST3 Genotypes in Patients With Alzheimer Disease and Control Subjects in 2 Independent Study Populations*
CST3 Genotypes in Patients With Alzheimer Disease and Control Subjects in 2 Independent Study Populations*
Table 2. 
Nonconditional Logistic Regression Analysis Findings for the Effects of APOE ϵ4, CST3 B/B, Sex, and Age on Risk of Alzheimer Disease*
Nonconditional Logistic Regression Analysis Findings for the Effects of APOE ϵ4, CST3 B/B, Sex, and Age on Risk of Alzheimer Disease*
Table 3. 
Odds Ratios for Alzheimer Disease in Association With CST3 or APOE Genotypes Calculated From the Combined Sample*
Odds Ratios for Alzheimer Disease in Association With CST3 or APOE Genotypes Calculated From the Combined Sample*
1.
St George-Hyslop  PH Molecular genetics of Alzheimer's disease. Biol Psychiatry. 2000;47183- 199Article
2.
Hutton  MPerez-Tur  JHardy  J Genetics of Alzheimer's disease. Essays Biochem. 1998;33117- 131
3.
Price  DLSisodia  SSBorchelt  DR Alzheimer's disease: when and why? Nat Genet. 1998;19314- 322Article
4.
Price  DLTanzi  REBorchelt  DRSisodia  SS Alzheimer's disease: genetic studies and transgenic models. Annu Rev Genet. 1998;32461- 493Article
5.
Blacker  DTanzi  RE The genetics of Alzheimer disease: current status and future prospects. Arch Neurol. 1998;55294- 296Article
6.
Finckh  UMüller-Thomsen  TMann  U  et al.  High prevalence of pathogenic mutations in patients with early-onset dementia detected by sequence analyses of four different genes. Am J Hum Genet. 2000;66110- 117Article
7.
Blacker  DWilcox  MALaird  NM  et al.  Alpha-2 macroglobulin is genetically associated with Alzheimer disease. Nat Genet. 1998;19357- 360Article
8.
Liao  ANitsch  RMGreenberg  SM  et al.  Genetic association of an alpha2-macroglobulin (Val1000lle) polymorphism and Alzheimer's disease. Hum Mol Genet. 1998;71953- 1956Article
9.
Bagli  MPapassotiropoulos  AJessen  FRao  MLMaier  WHeun  R Gene-gene interaction between interleukin-6 and alpha2-macroglobulin influences the risk for Alzheimer's disease. Ann Neurol. 2000;47138- 139Article
10.
Rogaeva  EAPremkumar  SGrubber  J  et al.  An alpha-2-macroglobulin insertion-deletion polymorphism in Alzheimer disease. Nat Genet. 1999;2219- 22Article
11.
Rudrasingham  VWavrant-De Vrieze  FLambert  JC  et al.  Alpha-2 macroglobulin gene and Alzheimer disease. Nat Genet. 1999;2217- 19Article
12.
Papassotiropoulos  ABagli  MKurz  A  et al.  A genetic variation of cathepsin D is a major risk factor for Alzheimer's disease. Ann Neurol. 2000;47399- 403Article
13.
Nicoll  JAMrak  REGraham  DI  et al.  Association of interleukin-1 gene polymorphisms with Alzheimer's disease. Ann Neurol. 2000;47365- 368Article
14.
Grimaldi  LMCasadei  VMFerri  C  et al.  Association of early-onset Alzheimer's disease with an interleukin-1 alpha gene polymorphism. Ann Neurol. 2000;47283- 285Article
15.
Abrahamson  M Cystatins. Methods Enzymol. 1994;244685- 700
16.
Pierre  PMellman  I Developmental regulation of invariant chain proteolysis controls MHC class II trafficking in mouse dendritic cells. Cell. 1998;931135- 1145Article
17.
Grubb  ALofberg  H Human gamma-trace, a basic microprotein: amino acid sequence and presence in the adenohypophysis. Proc Natl Acad Sci U S A. 1982;793024- 3027Article
18.
Thomas  TSchreiber  GJaworowski  A Developmental patterns of gene expression of 2q-secreted proteins in brain and choroid plexus. Dev Biol. 1989;13438- 47Article
19.
Cole  TDickson  PWEsnard  F  et al.  The cDNA structure and expression analysis of the genes for the cysteine proteinase inhibitor cystatin C and for beta 2-microglobulin in rat brain. Eur J Biochem. 1989;18635- 42Article
20.
Yasuhara  OHanai  KOhkubo  ISasaki  MMcGeer  PLKimura  H Expression of cystatin C in rat, monkey and human brains. Brain Res. 1993;62885- 92Article
21.
Lignelid  HCollins  VPJacobsson  B Cystatin C and transthyretin expression in normal and neoplastic tissues of the human brain and pituitary. Acta Neuropathol. 1997;93494- 500Article
22.
Palm  DEKnuckey  NWPrimiano  MJSpangenberger  AGJohanson  CE Cystatin C, a protease inhibitor, in degenerating rat hippocampal neurons following transient forebrain ischemia. Brain Res. 1995;6911- 8Article
23.
Ishimaru  HIshikawa  KOhe  YTakahashi  AMaruyama  Y Cystatin C and apolipoprotein E immunoreactivities in CA1 neurons in ischemic gerbil hippocampus. Brain Res. 1996;709155- 162Article
24.
Miyake  TGahara  YNakayama  MYamada  HUwabe  KKitamura  T Up-regulation of cystatin C by microglia in the rat facial nucleus following axotomy. Brain Res Mol Brain Res. 1996;37273- 282Article
25.
Katakai  KShinoda  MKabeya  K  et al.  Changes in distribution of cystatin C, apolipoprotein E and ferritin in rat hypothalamus after hypophysectomy. J Neuroendocrinol. 1997;9247- 253Article
26.
Vinters  HVNishimura  GSSecor  DLPardridge  WM Immunoreactive A4 and gamma-trace peptide colocalization in amyloidotic arteriolar lesions in brains of patients with Alzheimer's disease. Am J Pathol. 1990;137233- 240
27.
Cataldo  AMBarnett  JLPieroni  CNixon  RA Increased neuronal endocytosis and protease delivery to early endosomes in sporadic Alzheimer's disease: neuropathologic evidence for a mechanism of increased beta-amyloidogenesis. J Neurosci. 1997;176142- 6151
28.
Levy  ELopez-Otin  CGhiso  JGeltner  DFrangione  B Stroke in Icelandic patients with hereditary amyloid angiopathy is related to a mutation in the cystatin C gene, an inhibitor of cysteine proteases. J Exp Med. 1989;1691771- 1778Article
29.
Balbin  MAbrahamson  M SstII polymorphic sites in the promoter region of the human cystatin C gene. Hum Genet. 1991;87751- 752Article
30.
Balbin  MGrubb  AAbrahamson  M An Ala/Thr variation in the coding region of the human cystatin C gene (CST3) detected as a SstII polymorphism. Hum Genet. 1993;92206- 207Article
31.
Olafsson  I The human cystatin C gene promoter: functional analysis and identification of heterogeneous mRNA. Scand J Clin Lab Invest. 1995;55597- 607Article
32.
Nitsch  RMFinckh  UGal  A  et al.  Genetic association of CST3 with sporadic Alzheimer's disease. Soc Neurosci Abstr. 1999;251059
33.
Crawford  FFreeman  MJSchinka  J  et al.  The cystatin C gene is a novel genetic risk factor for late onset Alzheimer's disease [abstract]. Neurobiol Aging. 2000;21 (suppl 1) 204Article
34.
McKhann  GDrachman  DFolstein  MKatzman  RPrice  DStadian  EM Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA work group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology. 1984;34939- 944Article
35.
Cullum  CMRosenberg  RN Memory loss: when is it Alzheimer disease? JAMA. 1998;2791689- 1690Article
36.
Corder  EHSaunders  AMStrittmatter  EJ  et al.  Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science. 1993;261921- 923Article
37.
Kehoe  PWavrant-De Vrieze  FCrook  R  et al.  A full genome scan for late onset Alzheimer's disease. Hum Mol Genet. 1999;8237- 245Article
38.
Rebeck  GWReiter  JSStrickland  DKHyman  BT Apolipoprotein E in sporadic Alzheimer's disease: allelic variation and receptor interactions. Neuron. 1993;11575- 580Article
39.
Bales  KRVerina  TDodel  RCDu  YAltstiel  LBender  M Lack of apolipoprotein E dramatically reduces amyloid beta-peptide deposition. Nat Genet. 1997;17263- 264Article
40.
Growdon  JHLocascio  JJCorkin  SGomez-Isla  THyman  BT Apolipoprotein E genotype does not influence rates of cognitive decline in Alzheimer's disease. Neurology. 1996;47444- 448Article
41.
Munger  JSHaass  CLemere  CA  et al.  Lysosomal processing of amyloid precursor protein to A beta peptides: a distinct role for cathepsin S. Biochem J. 1995;311299- 305
42.
Lemere  CAMunger  JSShi  GP  et al.  The lysosomal cysteine protease, cathepsin S, is increased in Alzheimer's disease and Down syndrome brain: an immunocytochemical study. Am J Pathol. 1995;146848- 860
43.
Figueiredo-Pereira  MEEfthimiopoulos  STezapsidis  N  et al.  Distinct secretases, a cysteine protease and a serine protease, generate the C termini of amyloid beta-proteins A beta 1-40 and A beta 1-42, respectively. J Neurochem. 1999;721417- 1422Article
44.
Ghiso  JJensson  OFrangione  B Amyloid fibrils in hereditary cerebral hemorrhage with amyloidosis of Icelandic type is a variant of gamma-trace basic protein (cystatin C). Proc Natl Acad Sci U S A. 1986;832974- 2978Article
45.
Palsdottir  AAbrahamson  MThorsteinsson  L  et al.  Mutation in cystatin C gene causes hereditary brain haemorrhage. Prog Clin Biol Res. 1989;317241- 246
46.
Abrahamson  MGrubb  A Increased body temperature accelerates aggregation of the Leu-68→Gln mutant cystatin C, the amyloid-forming protein in hereditary cystatin C amyloid angiopathy. Proc Natl Acad Sci U S A. 1994;911416- 1420Article
Original Contribution
November 2000

Genetic Association of a Cystatin C Gene Polymorphism With Late-Onset Alzheimer Disease

Author Affiliations

From the Departments of Human Genetics (Drs Finckh and Zurdel and Messrs Menzer and Holst) and Psychiatry (Drs Müller-Thomsen and Mann and Ms Zuchowski), University Hospital Hamburg-Eppendorf, Hamburg-Eppendorf, Germany; the Center for Molecular Neurobiology, University of Hamburg, Hamburg, Germany (Drs von der Kammer, Müller-Thomsen, and Nitsch, Mr Velden, Mss Michel, Andresen, Zhang, and Zuchowski); the Department of Neurology, Massachusetts General Hospital, Boston, Mass (Drs Rebeck, Hyman, and Growdon and Ms Deng); the Department of Psychiatry, University of Bonn, Bonn, Germany (Drs Papassotiropoulos and Heun); the Departments of Psychiatry and Human Genetics, University of Goettingen, Goettingen, Germany (Drs Stoppe and Reiss); the University of Basel, Basel, Switzerland (Drs Miserez, Staehelin, and Hock); the Scientific Institute for Research and Patient Care, Brescia, Italy (Drs Benussi and Binetti); and the Division of Psychiatry Research, University of Zurich, Zurich, Switzerland (Drs Hock and Nitsch and Ms Michel).

Arch Neurol. 2000;57(11):1579-1583. doi:10.1001/archneur.57.11.1579
Abstract

Objective  To determine whether the cystatin C gene (CST3) is genetically associated with late-onset Alzheimer disease (AD).

Design  A case-control study with 2 independent study populations of patients with AD and age-matched, cognitively normal control subjects.

Setting  The Alzheimer's Disease Research Unit at the University Hospital Hamburg-Eppendorf, Hamburg, Germany, for the initial study (n = 260). For the independent multicenter study (n = 647), an international consortium that included the Massachusetts Alzheimer's Disease Research Center at the Massachusetts General Hospital, Boston; the Scientific Institute for Research and Patient Care, Brescia, Italy; and Alzheimer's research units at the Universities of Basel and Zurich, Switzerland, and Bonn, Goettingen, and Hamburg, Germany.

Participants  Five hundred seventeen patients with AD and 390 control subjects.

Measures  Molecular testing of the Ksp I polymorphisms in the 5′ flanking region and exon 1 of CST3 and the apolipoprotein E (APOE) genotype. Mini–Mental State Examination scores for both patients with AD and control subjects.

Results  Homozygosity for haplotype B of CST3 was significantly associated with late-onset AD in both study populations, with an odds ratio of 3.8 (95% confidence interval, 1.56-9.25) in the combined data set; heterozygosity was not associated with an increased risk. The odds ratios for CST3 B/B increased from 2.6 in those younger than 75 years to 8.8 for those aged 75 years and older. The association of CST3 B/B with AD was independent of APOE ϵ4; both genotypes independently reduced disease-free survival.

Conclusions  CST3 is a susceptibility gene for late-onset AD, especially in patients aged 75 years and older. To our knowledge, CST3 B is the first autosomal recessive risk allele in late-onset AD.

ALZHEIMER DISEASE (AD) is the major cause of dementia in the elderly. Familial forms of early-onset AD are caused by heterozygous mutations in the genes encoding the β-amyloid precursor protein (APP) and the presenilins PS1 and PS2, but the etiology of the much more prevalent forms of late-onset AD is unknown.16 Several susceptibility genes were reported to influence the risk of developing AD; of these, the effect of the apolipoprotein E gene (APOE) is now uniformly accepted, whereas additional putative genetic risk factors including α2-macroglobulin, interleukin 6, interleukin 1, and cathepsin D are matter of intense debate.714

Cystatin C is an endogenous proteinase inhibitor of the cathepsins B, H, L, and S.15 Cystatin C is a secretory protein, but it also reaches endocytic cellular compartments and inhibits cathepsin activities within the endosomal-lysosomal system.16 In the brain, cystatin C is synthesized by neurons, astrocytes, and choroid plexus cells,1721 and its levels increase in response to injury, including ischemia, axotomy, or surgery.20,2225 Neuronal concentrations of cystatin C are increased in AD, and cystatin C reportedly colocalizes with β-amyloid in arteriolar walls.26 The physiological function of cystatin C as a protease inhibitor is regulated either by dimerization or by endoproteolysis mediated by cathepsin D, which is also increased in early endosomes in AD brains.27

Cystatin C is also an amyloidogenic protein that accumulates in cortical blood vessels in hereditary cerebral hemorrhage with amyloidosis of both the Dutch and Icelandic types caused by mutations of the APP gene or the cystatin C gene (CST3), respectively.28CST3 maps to chromosome 20p11.2; it contains 3 exons, and 2 Ksp I polymorphisms are known in the 5′ untranslated sequence, combined with an additional Ksp I polymorphism that results in a threonine for alanine substitution at the penultimate position of the signal peptide.29,30 Because of linkage disequilibrium, these 3 polymorphisms in the CST3 gene result in only 2 commonly found human haplotypes, called CST3 A (nucleotides G, A, and G at positions −157, −72 and +73) and CST3 B (C, C, and A at these positions), respectively (Figure 1).31 In this study, we determined whether any of the CST3 genotypes are associated with a risk for late-onset AD. Evidence for an association of CST3 genotypes with AD has very recently been presented in abstract form.32,33

SUBJECTS AND METHODS
SUBJECTS

We conducted molecular genetic studies on 2 independent study populations: an initial sample (n = 260 participants), and a multicenter sample (n = 647 participants). The clinical diagnoses of AD were made according to the NINCDS-ADRDA criteria34; 84% of our patients had Mini–Mental State Examination (MMSE) scores lower than 24, similar to previous studies of AD.35 The control subjects were not demented, and had MMSE scores of 27 or higher. All participants in this study were Caucasian. Informed consent was obtained from all participants, and the local human studies committees approved the study protocol.

The initial sample included 110 patients with AD (aged 73.1 ± 8.9 years [mean ± SD]; 79 women) and 150 nondemented control subjects (aged 65.2 ± 14.6 years [mean ± SD]; 66 women) from the Alzheimer's Disease Research Unit at the University Hospital Hamburg-Eppendorf, Germany. An independent hypothesis-testing sample was collected according to identical standardized criteria by an international multi-institutional consortium that included AD research units in the United States, Italy, Germany, and Switzerland. This sample consisted of 407 patients with AD (aged 75.0 ± 9.5 years [mean ± SD]; 284 women) and 240 age-matched nondemented controls (aged 75.1 ± 6.3 years [mean ± SD]; 139 women).

GENOTYPING

Preparations of DNA and polymerase chain reactions (PCRs) were performed following standard protocols.29 The 318–base pair (bp) PCR product generated with primers 024F (TGGGAGGGACGAGGCGTTCC) and 1206R (TCCATGGGGCCTCCCACCAG) was designed to cover all 3 polymorphic Ksp I sites described above. Digestion with Ksp I generated 3 fragments of 41, 226, and 51 bp in size for haplotype A, or 2 fragments of 127 and 191 bp for haplotype B. These banding patterns allowed us to determine the phase of the polymorphisms. Among the 907 samples genotyped in this study, there was no case of aberrant banding pattern in this assay, confirming that no other haplotypes defined by these 3 polymorphic sites were present in our study population. In addition, we confirmed these haplotypes by direct sequencing of PCR products from subjects with the respective genotypes A/A, A/B, or B/B. APOE was routinely genotyped by using a standard PCR- and restriction-based protocol.36 The observed CST3 and APOE genotype counts did not significantly deviate from those expected under the Hardy Weinberg equilibrium of patients and controls in the initial, the multicenter, or the combined samples.

RESULTS
INITIAL STUDY

There was a significant association between AD and CST3 genotype (χ22 = 6.67; 2-sided Fisher exact test, P = .04) (Table 1). The borderline higher frequency of allele B (FB) in patients (25%) than in controls (18%) (Pearson χ2 = 3.75; P = .05) was due to an excess of B/B homozygotes in the patients with AD (9.1%) compared with the control subjects (2.0%). The proportion of A/B heterozygotes in the patient and control groups was almost identical. These data suggested an odds ratio (OR) for AD of 4.9 (95% confidence interval [CI], 1.32-18.25) in association with the homozygous genotype B/B. As expected, there was also a highly significant association between APOE genotype and AD. Of the patients with AD, 13.6% were homozygous for the ϵ4 allele, compared with 2.7% of the control subjects; 50.0% of patients with AD were heterozygous ϵ3/ϵ4 or ϵ2/ϵ4 (control subjects, 29.3%), and 36.4% of the patients with AD had no ϵ4 allele, vs 68% of the controls (χ22 = 29.2; P<.001). Nonconditional logistic regression analysis revealed a comparably strong effect of CST3 B/B on the individual risk for AD as the presence of an APOE ϵ4 allele (Table 2). Nonconditional logistic regression analyses revealed significant effects on the risk for AD of APOE ϵ4, CST3 B/B, sex, and age, but we did not find evidence for significant interactions between APOE and CST3.

MULTICENTER STUDY

There were no significant differences in CST3 allele frequencies in the independently collected control and patient samples obtained by the multicenter consortium: The FB in patients from the United States, Italy, Germany, and Switzerland were 0.24, 0.20, 0.21, and 0.21, respectively (χ23 = 0.96; P = .81) and those in control subjects were 0.13, 0.19, 0.18, and 0.17, respectively (χ23 = 1.14; P = .77). Moreover, the expected association between APOE genotype and AD was confirmed in the samples from each center (2-sided Fisher exact test, P≤ .004; df = 2, for each center). Together, these characteristics allowed us to combine the samples and gain sufficient statistical power to test the hypotheses suggested by the results of the initial study. There was a significant association between CST3 B/B and AD (χ21 = 5.37; 2-sided Fisher exact test, P = .02). The statistically nonsignificantly higher FB in the patients (21%) than in controls (17%) (Pearson χ2 = 2.61; P = .11) was again due to an excess of homozygous carriers of the B allele in the AD group (4.7%) compared with the control subjects (1.3%). The OR for AD in association with B/B in the multicenter sample was 3.87 (95% CI, 1.13-13.21). Regression analysis revealed no significant interaction between APOE and CST3.

COMBINED SAMPLE

Analysis of the combined sample of 907 participants confirmed that CST3 was significantly associated with AD, with an OR of 3.8 (95% CI, 1.56-9.25; P = .001). In the same sample, the ORs for APOE ϵ4 heterozygosity and homozygosity were 3.09 and 6.91, respectively (Table 3). CST3 and APOE independently affected the risk for AD, because the ORs for AD in association with CST3 B/B were similar in APOE ϵ4–negative (3.07; 95% CI, 1.16-8.12; P = .02) and APOE ϵ4–positive participants. In addition to the independent risks of developing AD, these 2 risk factors combined lowered the age of disease onset. Of all patients with AD, 2.9% carried 2 CST3 B alleles as well as at least 1 APOE ϵ4 allele, compared with none of the 390 control subjects (χ21 = 11.51; 2-sided Fisher exact test, P<.001). These patients with AD with both risk factors had a mean ± SD age of onset of 69.1 ± 9.5 years compared with 75.0 ± 9.5 years in the overall patient sample.

Results of Kaplan-Meier survival analyses revealed that CST3 B/B reduced mean disease-free survival from 77 years (SE = 0; 95% CI, 76-78 years) in CST3 A/A and A/B patients with AD to 73 years (SE = 2; 95% CI, 70-76 years; log rank P = .05; df = 1). Parallel analyses confirmed the known effects of APOE on mean disease-free survival; in this sample, 80 years in ϵ4–negative (SE = 1; 95% CI, 78-81 years), 73 years in ϵ4–heterozygous (SE = 1; 95% CI, 72-75 years), and 70 years in ϵ4–homozygous patients with AD (SE = 1; 95% CI, 68-72 years) (log rank P<.001; df = 2).

COMMENT

The results of this study establish a genetic association between CST3 B/B and AD. There was an excess of the CST3 B/B genotype among patients with AD compared with control subjects in 2 independent study populations. CST3 B/B was present in 4.7% to 9.1% of our patients with AD compared with 10% to 14% APOE ϵ4/ϵ4 in this study. In addition, CST3 B/B significantly reduced the average disease-free survival by 4 years. Both effects seemed to be independent of APOE genotype. Together with the absence of CST3 B/B in cognitively normal control subjects older than 74 years, these data indicate that CST3 B/B is a risk factor for late-onset AD. Although statistically significant in this association study, it may be difficult to detect effects of this magnitude with microsatellite markers in whole genome scans of 300 to 600 sib pairs. This difficulty may explain the reported absence of positive LOD scores at chromosome 20p11.2, the genomic region of CST3.37

Of the susceptibility genes reported to influence the risk of developing AD, the effects of the APOE ϵ4 allele are best known and accepted. Carrying the ϵ4 allele increases the risk of developing AD and lowers the age of dementia onset in a dose-dependent fashion, whereas the ϵ2 allele may protect against AD, or at least delay its onset. The mechanisms by which APOE affects AD are unknown, although there is an ϵ4 dose-dependent increase in brain amyloid deposits,38 and amyloid plaques are reduced in transgenic mice lacking APOE.39APOE genotypes do not influence the rate of cognitive decline once dementia sets in.40 Because the influence of APOE is so pervasive in AD, we determined the APOE genotypes of our patients and control subjects to distinguish APOE from CST3 effects. In doing so, we confirmed in our populations' prior reports that the APOE ϵ4 allele was associated with sporadic late-onset AD, and that APOE ϵ4 shortened the mean dementia-free survival time. We also documented that the association of the CST3 B/B genotype with sporadic late-onset AD was independent of APOE, as indicated by a similar OR of CST3 B/B for AD in APOE ϵ4–negative subjects compared with APOE ϵ4–positive participants. Because 2.9% of our patients with AD but none of the control subjects were APOE ϵ4–positive CST3 B/B carriers, additive effects of APOE and CST3 cannot be excluded in this group of patients.

In contrast to APOE ϵ4, the heterozygous B allele did not reduce mean age of onset or survival. It is therefore possible that the effects of the CST3 B allele on the risk of AD followed a recessive pattern, suggesting that CST3 B may represent a recessive risk allele for late-onset AD. In the participants of this study, the OR of CST3 B/B for AD increased with advancing age from 2.59 at ages younger than 75 years to 8.78 in the age group 75 years and older, suggesting that the risk of AD attributable to CST3 B/B reaches its maximum at an older age than the risk attributable to APOE ϵ4, and that CST3 B/B is a risk factor particularly for late-onset AD. This pattern differs from the effects of APOE, which peak in the seventh and eighth decades of life and then decline thereafter.

The role of cystatin C in the pathogenesis of AD is unknown. Cystatin C is initially synthesized with an N-terminal hydrophobic signal sequence that is removed during synthesis. The Ksp I polymorphism in CST3 results in an amino acid exchange from alanine to threonine at the –2 position for signal peptidase cleavage (Figure 1, B). This variation alters the hydrophobicity profile of the signal sequence, and it reduces its ratio of predicted α-helix to β-sheet contents by approximately 42%. This variation could be associated with changes in secretory processing of cystatin C, but our data do not provide information whether such changes are disease-related or the polymorphism tested in this study is in linkage disequilibrium with another disease-related polymorphism upstream or downstream of the analyzed sequence.

Cystatin C is increased in AD brains, along with its high-affinity substrate cathepsin S that is known to cleave APP into β-amyloid peptide (Aβ)–containing derivatives in vitro, and to increase Aβ generation in tissue culture.41,42 Cystatin C inhibits cathepsins with a profile that is similar to that of the cysteine protease inhibitor E-64, which is known to differentially affect γ40- and γ42-secretase processing of APP.15,43 Further studies are required to test whether cystatin C has similar activities on APP processing, Aβ generation, and amyloid deposition, and whether these differ among the 2 allelic variants.

The Icelandic form of hereditary cerebral hemorrhage with amyloidosis (HCHWA-I) is caused by a leucine-to-glutamine mutation at position 68 in cystatin C.44,45 As a result of this mutation, cystatin C amyloid aggregates more readily than the wild-type form.46 The HCHWA-I is characterized by recurrent strokes and premature death before age 40 years and is associated with the deposition in brain blood vessels of cystatin C amyloid. This disease is clearly different from late-onset AD dementia in which there is no point mutation in cystatin C at position 68. Instead, our genotype data provide evidence for a contribution of CST3 B/B as a genetic risk factor to the multifactorial etiology of late-onset AD. Whether CST3 exerts this effect by influencing amyloid deposition, the inflammatory response, or by some other mechanism remains to be determined.

Back to top
Article Information

Accepted for publication August 4, 2000.

This study was supported in part by grants from the Alzheimer's Association, Chicago, Ill (IIGR-99-1755); Telethon-Italy, Rome (E1084); and the National Institute on Aging, Bethesda, Md (P50 AG05134).

Reprints: Roger M. Nitsch, MD, Division of Psychiatry Research, University of Zurich, August Forel Str 1, 8008 Zurich, Switzerland (e-mail: nitsch@bli.unizh.ch).

References
1.
St George-Hyslop  PH Molecular genetics of Alzheimer's disease. Biol Psychiatry. 2000;47183- 199Article
2.
Hutton  MPerez-Tur  JHardy  J Genetics of Alzheimer's disease. Essays Biochem. 1998;33117- 131
3.
Price  DLSisodia  SSBorchelt  DR Alzheimer's disease: when and why? Nat Genet. 1998;19314- 322Article
4.
Price  DLTanzi  REBorchelt  DRSisodia  SS Alzheimer's disease: genetic studies and transgenic models. Annu Rev Genet. 1998;32461- 493Article
5.
Blacker  DTanzi  RE The genetics of Alzheimer disease: current status and future prospects. Arch Neurol. 1998;55294- 296Article
6.
Finckh  UMüller-Thomsen  TMann  U  et al.  High prevalence of pathogenic mutations in patients with early-onset dementia detected by sequence analyses of four different genes. Am J Hum Genet. 2000;66110- 117Article
7.
Blacker  DWilcox  MALaird  NM  et al.  Alpha-2 macroglobulin is genetically associated with Alzheimer disease. Nat Genet. 1998;19357- 360Article
8.
Liao  ANitsch  RMGreenberg  SM  et al.  Genetic association of an alpha2-macroglobulin (Val1000lle) polymorphism and Alzheimer's disease. Hum Mol Genet. 1998;71953- 1956Article
9.
Bagli  MPapassotiropoulos  AJessen  FRao  MLMaier  WHeun  R Gene-gene interaction between interleukin-6 and alpha2-macroglobulin influences the risk for Alzheimer's disease. Ann Neurol. 2000;47138- 139Article
10.
Rogaeva  EAPremkumar  SGrubber  J  et al.  An alpha-2-macroglobulin insertion-deletion polymorphism in Alzheimer disease. Nat Genet. 1999;2219- 22Article
11.
Rudrasingham  VWavrant-De Vrieze  FLambert  JC  et al.  Alpha-2 macroglobulin gene and Alzheimer disease. Nat Genet. 1999;2217- 19Article
12.
Papassotiropoulos  ABagli  MKurz  A  et al.  A genetic variation of cathepsin D is a major risk factor for Alzheimer's disease. Ann Neurol. 2000;47399- 403Article
13.
Nicoll  JAMrak  REGraham  DI  et al.  Association of interleukin-1 gene polymorphisms with Alzheimer's disease. Ann Neurol. 2000;47365- 368Article
14.
Grimaldi  LMCasadei  VMFerri  C  et al.  Association of early-onset Alzheimer's disease with an interleukin-1 alpha gene polymorphism. Ann Neurol. 2000;47283- 285Article
15.
Abrahamson  M Cystatins. Methods Enzymol. 1994;244685- 700
16.
Pierre  PMellman  I Developmental regulation of invariant chain proteolysis controls MHC class II trafficking in mouse dendritic cells. Cell. 1998;931135- 1145Article
17.
Grubb  ALofberg  H Human gamma-trace, a basic microprotein: amino acid sequence and presence in the adenohypophysis. Proc Natl Acad Sci U S A. 1982;793024- 3027Article
18.
Thomas  TSchreiber  GJaworowski  A Developmental patterns of gene expression of 2q-secreted proteins in brain and choroid plexus. Dev Biol. 1989;13438- 47Article
19.
Cole  TDickson  PWEsnard  F  et al.  The cDNA structure and expression analysis of the genes for the cysteine proteinase inhibitor cystatin C and for beta 2-microglobulin in rat brain. Eur J Biochem. 1989;18635- 42Article
20.
Yasuhara  OHanai  KOhkubo  ISasaki  MMcGeer  PLKimura  H Expression of cystatin C in rat, monkey and human brains. Brain Res. 1993;62885- 92Article
21.
Lignelid  HCollins  VPJacobsson  B Cystatin C and transthyretin expression in normal and neoplastic tissues of the human brain and pituitary. Acta Neuropathol. 1997;93494- 500Article
22.
Palm  DEKnuckey  NWPrimiano  MJSpangenberger  AGJohanson  CE Cystatin C, a protease inhibitor, in degenerating rat hippocampal neurons following transient forebrain ischemia. Brain Res. 1995;6911- 8Article
23.
Ishimaru  HIshikawa  KOhe  YTakahashi  AMaruyama  Y Cystatin C and apolipoprotein E immunoreactivities in CA1 neurons in ischemic gerbil hippocampus. Brain Res. 1996;709155- 162Article
24.
Miyake  TGahara  YNakayama  MYamada  HUwabe  KKitamura  T Up-regulation of cystatin C by microglia in the rat facial nucleus following axotomy. Brain Res Mol Brain Res. 1996;37273- 282Article
25.
Katakai  KShinoda  MKabeya  K  et al.  Changes in distribution of cystatin C, apolipoprotein E and ferritin in rat hypothalamus after hypophysectomy. J Neuroendocrinol. 1997;9247- 253Article
26.
Vinters  HVNishimura  GSSecor  DLPardridge  WM Immunoreactive A4 and gamma-trace peptide colocalization in amyloidotic arteriolar lesions in brains of patients with Alzheimer's disease. Am J Pathol. 1990;137233- 240
27.
Cataldo  AMBarnett  JLPieroni  CNixon  RA Increased neuronal endocytosis and protease delivery to early endosomes in sporadic Alzheimer's disease: neuropathologic evidence for a mechanism of increased beta-amyloidogenesis. J Neurosci. 1997;176142- 6151
28.
Levy  ELopez-Otin  CGhiso  JGeltner  DFrangione  B Stroke in Icelandic patients with hereditary amyloid angiopathy is related to a mutation in the cystatin C gene, an inhibitor of cysteine proteases. J Exp Med. 1989;1691771- 1778Article
29.
Balbin  MAbrahamson  M SstII polymorphic sites in the promoter region of the human cystatin C gene. Hum Genet. 1991;87751- 752Article
30.
Balbin  MGrubb  AAbrahamson  M An Ala/Thr variation in the coding region of the human cystatin C gene (CST3) detected as a SstII polymorphism. Hum Genet. 1993;92206- 207Article
31.
Olafsson  I The human cystatin C gene promoter: functional analysis and identification of heterogeneous mRNA. Scand J Clin Lab Invest. 1995;55597- 607Article
32.
Nitsch  RMFinckh  UGal  A  et al.  Genetic association of CST3 with sporadic Alzheimer's disease. Soc Neurosci Abstr. 1999;251059
33.
Crawford  FFreeman  MJSchinka  J  et al.  The cystatin C gene is a novel genetic risk factor for late onset Alzheimer's disease [abstract]. Neurobiol Aging. 2000;21 (suppl 1) 204Article
34.
McKhann  GDrachman  DFolstein  MKatzman  RPrice  DStadian  EM Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA work group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology. 1984;34939- 944Article
35.
Cullum  CMRosenberg  RN Memory loss: when is it Alzheimer disease? JAMA. 1998;2791689- 1690Article
36.
Corder  EHSaunders  AMStrittmatter  EJ  et al.  Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families. Science. 1993;261921- 923Article
37.
Kehoe  PWavrant-De Vrieze  FCrook  R  et al.  A full genome scan for late onset Alzheimer's disease. Hum Mol Genet. 1999;8237- 245Article
38.
Rebeck  GWReiter  JSStrickland  DKHyman  BT Apolipoprotein E in sporadic Alzheimer's disease: allelic variation and receptor interactions. Neuron. 1993;11575- 580Article
39.
Bales  KRVerina  TDodel  RCDu  YAltstiel  LBender  M Lack of apolipoprotein E dramatically reduces amyloid beta-peptide deposition. Nat Genet. 1997;17263- 264Article
40.
Growdon  JHLocascio  JJCorkin  SGomez-Isla  THyman  BT Apolipoprotein E genotype does not influence rates of cognitive decline in Alzheimer's disease. Neurology. 1996;47444- 448Article
41.
Munger  JSHaass  CLemere  CA  et al.  Lysosomal processing of amyloid precursor protein to A beta peptides: a distinct role for cathepsin S. Biochem J. 1995;311299- 305
42.
Lemere  CAMunger  JSShi  GP  et al.  The lysosomal cysteine protease, cathepsin S, is increased in Alzheimer's disease and Down syndrome brain: an immunocytochemical study. Am J Pathol. 1995;146848- 860
43.
Figueiredo-Pereira  MEEfthimiopoulos  STezapsidis  N  et al.  Distinct secretases, a cysteine protease and a serine protease, generate the C termini of amyloid beta-proteins A beta 1-40 and A beta 1-42, respectively. J Neurochem. 1999;721417- 1422Article
44.
Ghiso  JJensson  OFrangione  B Amyloid fibrils in hereditary cerebral hemorrhage with amyloidosis of Icelandic type is a variant of gamma-trace basic protein (cystatin C). Proc Natl Acad Sci U S A. 1986;832974- 2978Article
45.
Palsdottir  AAbrahamson  MThorsteinsson  L  et al.  Mutation in cystatin C gene causes hereditary brain haemorrhage. Prog Clin Biol Res. 1989;317241- 246
46.
Abrahamson  MGrubb  A Increased body temperature accelerates aggregation of the Leu-68→Gln mutant cystatin C, the amyloid-forming protein in hereditary cystatin C amyloid angiopathy. Proc Natl Acad Sci U S A. 1994;911416- 1420Article
×