[Skip to Content]
Sign In
Individual Sign In
Create an Account
Institutional Sign In
OpenAthens Shibboleth
[Skip to Content Landing]
Download PDF
Figure 1.
Family with childhood absence epilepsy with IVS6 + 2T→G mutation. A, Pedigree of family 510. Affected individuals are indicated by solid symbols. B, Sequencing of genomic DNA from the index patient II-1. C, MboII restriction analysis of the IVS6 + 2T→G splice–donor site mutation in family 510. The 15–base pair (bp) restriction fragment is not shown. D, TasI restriction analysis of the C588T polymorphism in exon 5. Homozygote or heterozygote from control DNA for both alleles are shown. Smaller fragments (36 bp, 17 bp, 8 bp, 6 bp) are not shown.

Family with childhood absence epilepsy with IVS6 + 2T→G mutation. A, Pedigree of family 510. Affected individuals are indicated by solid symbols. B, Sequencing of genomic DNA from the index patient II-1. C, MboII restriction analysis of the IVS6 + 2T→G splice–donor site mutation in family 510. The 15–base pair (bp) restriction fragment is not shown. D, TasI restriction analysis of the C588T polymorphism in exon 5. Homozygote or heterozygote from control DNA for both alleles are shown. Smaller fragments (36 bp, 17 bp, 8 bp, 6 bp) are not shown.

Figure 2.
Probable effect of the IVS6 + 2T→G on GABRG2 structure. A, Exon 6 and the adjacent part of intron 6, including an in-frame stop codon and 2 strong cryptic splice–donor sites within the intron. B, Exon-intron structure of GABRG2. The intron 6-splice–donor site mutation is indicated by the arrow. Exons are not drawn according to size. C, Schematic representation of the probable outcome of exon 6 skipping. The excision of introns 5 and 6 and exon 6 followed by the fusion of exons 5 and 7 would create an in-frame stop codon. bp indicates base pair; kb, kilobase.

Probable effect of the IVS6 + 2T→G on GABRG2 structure. A, Exon 6 and the adjacent part of intron 6, including an in-frame stop codon and 2 strong cryptic splice–donor sites within the intron. B, Exon-intron structure of GABRG2. The intron 6-splice–donor site mutation is indicated by the arrow. Exons are not drawn according to size. C, Schematic representation of the probable outcome of exon 6 skipping. The excision of introns 5 and 6 and exon 6 followed by the fusion of exons 5 and 7 would create an in-frame stop codon. bp indicates base pair; kb, kilobase.

Genotype and Allele Frequencies of the GABRG2 Exon 5 Polymorphism, C588T*
Genotype and Allele Frequencies of the GABRG2 Exon 5 Polymorphism, C588T*
1.
Duncan  JS Idiopathic generalized epilepsies with typical absences. J Neurol.1997;244:403-411.
2.
Schuman  SHMiller  LJ Febrile convulsions in families: findings in an epidemiologic survey. Clin Pediatr (Phila).1966;5:604-608.
3.
Van der Berg  BJYerushalmy  J Studies on convulsive disorders in young children, I: incidence of febrile and nonfebrile convulsions by age and other factors. Pediatr Res.1969;3:298-304.
4.
Nelson  KBEllenberg  JH Prognosis in children with febrile seizures. Pediatrics.1978;61:720-727.
5.
Berkovic  SFScheffer  IE Febrile seizures: genetics and relationship to other epilepsy syndromes. Curr Opin Neurol.1998;11:129-134.
6.
Italian League Against Epilepsy Genetic Collaborative Group Concordance of clinical forms of epilepsy in families with several affected members. Epilepsia.1993;34:819-826.
7.
Scheffer  IEBerkovic  SF Generalized epilepsy with febrile seizures plus: a genetic disorder with heterogeneous clinical phenotypes. Brain.1997;120:479-490.
8.
Singh  RScheffer  IECrossland  KBerkovic  SF Generalized epilepsy with febrile seizures plus: a common childhood-onset genetic epilepsy syndrome. Ann Neurol.1999;45:75-81.
9.
Wallace  RHWang  DWSingh  R  et al Febrile seizures and generalized epilepsy associated with a mutation in the Na+-channel beta1 subunit gene SCN1B. Nat Genet.1998;19:366-370.
10.
Escayg  AMacDonald  BTMeisler  MH  et al Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet.2000;24:343-345.
11.
Sugawara  TTsurubuchi  YAgarwala  KL  et al A missense mutation of the Na+ channel alpha II subunit gene Na(v)1.2 in a patient with febrile and afebrile seizures causes channel dysfunction. Proc Natl Acad Sci U S A.2001;98:6384-6389.
12.
Baulac  SHuberfeld  GGourfinkel-An  I  et al First genetic evidence of GABA(A) receptor dysfunction in epilepsy: a mutation in the gamma2-subunit gene. Nat Genet.2001;28:46-48.
13.
Wallace  RHMarini  CPetrou  S  et al Mutant GABA(A) receptor gamma2-subunit in childhood absence epilepsy and febrile seizures. Nat Genet.2001;28:49-52.
14.
Olsen  RWAvoli  M GABA and epileptogenesis. Epilepsia.1997;38:399-407.
15.
Snodgrass  SR GABA and epilepsy: their complex relationship and the evolution of our understanding. J Child Neurol.1992;7:77-86.
16.
Gadea  ALopez-Colome  AM Glial transporters for glutamate, glycine, and GABA, II: GABA transporters. J Neurosci Res.2001;63:461-468.
17.
Not Available Commission on Classification and Terminology of the International League Against Epilepsy proposal for revised classification of epilepsies and epileptic syndromes. Epilepsia.1998;30:389-399.
18.
Miller  SADykes  DPlesky  HF A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res.1988;16:1215.
19.
Not Available SAS/STAT User's Guide, Release 6.03 Edition.  Cary, NC: SAS Institute; 1988.
20.
Talerico  MBerget  SM Effect of 5′ splice site mutations on splicing of the preceding intron. Mol Cell Biol.1990;10:6299-6305.
21.
Nakai  KSakamoto  H Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene.1994;141:171-177.
22.
Anderson  SLColi  RDaly  IW  et al Familial dysautonomia is caused by mutations of the IKAP gene. Am J Hum Genet.2001;68:753-758.
23.
Whiting  PMcKernan  RMIversen  LL Another mechanism for creating diversity in gamma-aminobutyrate type A receptors: RNA splicing directs expression of two forms of gamma 2 phosphorylation site. Proc Natl Acad Sci U S A.1990;87:9966-9970.
Original Contribution
July 2002

A Splice-Site Mutation in GABRG2 Associated With Childhood Absence Epilepsy and Febrile Convulsions

Author Affiliations

From the Institute of Human Genetics (Mss Kananura, Gu, and Hallmann, and Drs Haug, Heils, and Steinlein), and Department of Epileptology (Drs Rebstock and Heils), University Hospital Bonn, Rheinische Friedrich Wilhelms-University Bonn, Bonn; Department of Neurology, University Hospital Charité, Humboldt University of Berlin, Berlin (Dr Sander); and Department of Neurology, University Hospital Greifswald, Ernst Moritz Arndt-University, Greifswald (Dr Runge), Germany.

Arch Neurol. 2002;59(7):1137-1141. doi:10.1001/archneur.59.7.1137
Abstract

Context  Missense mutations in the GABRG2 gene, which encodes the γ2 subunit of central nervous γ-aminobutyric acid (GABA)A receptors, have recently been described in 2 families with idiopathic epilepsy. In one of these families, the affected individuals predominantly exhibited childhood absence epilepsy and febrile convulsions.

Objective  To assess the role of GABRG2 in the genetic predisposition to idiopathic absence epilepsies.

Design  The GABRG2 gene was screened by single-strand conformation analysis for mutations. Furthermore, a population-based association study assessing a common exon 5 polymorphism (C588T) was carried out.

Patients  The sample was composed of 135 patients with idiopathic absence epilepsy and 154 unrelated and ethnically matched controls.

Results  A point mutation (IVS6 + 2T→G) leading to a splice–donor site mutation in intron 6 was found. The mutation, which is predicted to lead to a nonfunctional protein, cosegregates with the disease status in a family with childhood absence epilepsy and febrile convulsions. The association study did not find any significant differences in the allele and genotype frequencies of the common exon 5 polymorphism (C588T) between patients with idiopathic absence epilepsy and controls (P>.35).

Conclusions  Our study identified a splice–donor-site mutation that was probably causing a nonfunctional GABRG2 subunit. This mutation occurred in heterozygosity in the affected members of a single nuclear family, exhibiting a phenotypic spectrum of childhood absence epilepsy and febrile convulsions. The GABRG2 gene seems to confer a rare rather than a frequent major susceptibility effect to common idiopathic absence epilepsy syndromes.

CHILDHOOD ABSENCE epilepsy (CAE) is one of the most common subtypes of idiopathic generalized epilepsy (IGE). It is characterized by daily clusters of absence seizures at an age of onset between 2 and 12 years.1

Febrile convulsions (FCs) are the most common seizure subtypes, affecting about 3% to 5% of children younger than 6 years.24 While CAE is often followed by other IGE syndromes, including generalized tonic-clonic seizures and myoclonic seizures, only 3% to 7% of children suffering from FCs develop epilepsy later in life.5

A genetic basis for both CAE and FC is well established.5 Because the incidence of FC is significantly increased in patients with CAE (10%-15%) compared with the general population, a genetic overlap between both of these disorders has been suggested.6 Such a common molecular basis is most obvious in the syndrome of "generalized epilepsy with febrile seizures plus" (GEFS+), a monogenic or oligogenic epilepsy that was first described in 1997.7 Generalized epilepsy with febrile seizures plus is characterized by FCs that may persist beyond the age of 6 years and are often followed by generalized seizures, including myoclonic and absence seizures.8

While the molecular basis of common forms of seizure disorders, including FC and CAE has been elusive so far, disease-causing GEFS+ mutations have already been identified in SCN1B, SCN1A, SCN2A, and GABRG2, genes encoding neuronal sodium channel subtypes and the γ2-subunit of central nervous γ-aminobutyric acid (GABA)A receptors, respectively.913 A potential role of the GABAergic system has often been implicated in epileptogenesis1416; however, genetic evidence for this hypothesis has been obtained only recently by the discovery of different GABRG2 mutations identified in 2 families. The phenotype in one of these families was described to be compatible with GEFS+, but no further details regarding the seizure types observed in the affected pedigree members were given.12 In the second family affected, individuals predominantly had CAE and FC.13 Accordingly, these findings raise the question whether genetic variation of the GABRG2 gene confers susceptibility to the epileptogenesis of common subtypes of idiopathic absence epilepsies (IAEs). We therefore systematically searched for mutations and common sequence variants in a sample comprising a total of 135 patients with IAE and performed a population-based association study assessing a frequent silent polymorphism (C588T) in exon 5 of the GABRG2 gene.

PATIENTS AND METHODS
PATIENTS

The study sample included 135 unrelated German patients with IAE at the University Hospital Rudolf Virchow at the Free University of Berlin (Berlin, Germany) and at the University Hospital of Bonn (Bonn, Germany). The sample consisted of 59 patients with juvenile AE and 46 patients with CAE who had at least 1 first-degree family member affected by IGE. In addition, 19 patients with juvenile AE and 11 with CAE were included as sporadic cases. The study protocol was approved by the local ethics committees, and written informed consent was obtained from all participants. Diagnostic criteria for IAE (CAE or juvenile AE) were: (1) onset with typical absence seizures; (2) age at onset of typical absence seizures between 3 and 20 years; (3) electroencephalographic (EEG) findings of normal background activity and paroxysmal generalized spike-wave EEG discharges; and (4) normal intellectual and neurological status apart from seizures. Exclusion criteria included (1) evidence for structural lesions or metabolic or degenerative diseases of the brain; (2) atonic/astatic or tonic seizures; (3) complex partial seizures; (4) epilepsy with myoclonic absences; and (5) exclusively stimulus-induced seizures.17 In case of a rare mutation in the sample of patients with IAE, we assessed the presence of the latter in a sample comprising 88 unrelated and ethnically matched controls. For the association study, we obtained the genotype and allele frequencies in all 135 patients as well as in 154 unrelated and ethnically matched controls. All controls were healthy volunteers of German descent.

FAMILY 510

The 15-year-old index patient (II-1) had exhibited typical pyknoleptic absence seizures starting at the age of 4 years (syndrome diagnosis: CAE) and experienced 3 uncomplicated FCs at age 4 years. In addition, he had 1 generalized tonic-clonic seizure at age 10 and 1 at age 11 years. His interictal EEG results showed 3/s generalized spike-wave discharges during resting as well as photosensitivity. At age 12 years, he began daily treatment with 1800 mg of valproic acid and had been free of seizures since that time. His 13-year-old sister (II-2) had 4 uncomplicated FCs at age 3 years. She exhibited typical absence seizures and several generalized tonic-clonic seizures at age 4 years (syndrome diagnosis: CAE). Results of her interictal EEG showed 3/s generalized spike-wave discharges while resting. Valproic acid treatment was started and she had been seizure-free since then. The 42-year-old father (I-1) had experienced 20 uncomplicated FCs between the ages of 3 and 6 years. From ages 6 to 15 years, he was treated with phenobarbital and ethosuximide and remained seizure-free without antiepileptic treatment. He had no siblings and his parents had no known history of seizures. The 43-year-old mother (I-2) reported no history of epileptic seizures.

MUTATION SCREENING

Genomic DNA was extracted either from 10-mL aliquots of EDTA-anticoagulated blood samples or from lymphoblastoid cell lines, using a salting-out method.18 For single-strand conformation analysis, we designed specific primer sets amplifying all GABRG2 exons and adjacent exon-intron boundaries (primer sequences are available on request). Polymerase chain reactions (PCRs) were carried out in a PTC 200 (MJ Research, Waltham, Mass), that contained a total 25-µL volume comprised of 50 ng of genomic DNA, 5 pmol each of forward and reverse primers, 200µM each of dinucleotide triphosphate, 1.5mM of magnesium chloride, 50mM of potassium chloride, 20mM of Tris hydrochloride (pH 8.3), and 0.1 U of Taq DNA polymerase. Polymerase chain reaction parameters were as follows: denaturation at 95°C for 5 minutes followed by 33 cycles at 95°C for 30 seconds, annealing at 58°C to 64°C for 30 seconds, and extension at 72°C for 30 seconds followed by a final extension step of 5 minutes at 72°C. The obtained PCR products were denatured and run on 10% polyacrylamide gels for 14 to 16 hours at room temperature and at 4°C, respectively. After the run, the bands were visualized using a standard silver-staining protocol. Polymerase chain reaction products showing aberrant patterns were amplified again prior to direct sequencing with an ABI 377 sequencer (Applied Biosystems, Foster City, Calif). For verification of the mutation and screening of the control sample, we developed a restriction fragment length assay using primers n1005 (5′ATGTGAGCTTTCCTATCTCACG) and Z n1070 (5′TGAGAGGTATTGAAAAATCCTCTA). The resulting PCR fragment included exon 6 and adjacent sequences from introns 5 and 6. MboII (MBI Fermentas, St Leon Roth, Germany) digests of PCR products gave the following fragments: wild type allele, 110 base pair (bp) + 90 bp + 53 bp; mutant allele, 110 bp + 75 bp + 53 bp + 15 bp.

EXON 5 POLYMORPHISM (C588T)

Exon 5 and the adjacent parts of introns 4 and 5 were amplified using primers n1065 (5′CCATCTTATGTTTAATATCTTTCT) and n1066 (5′ACTGTAGGTGAGGGAGGATAC). Digestion of the PCR product with restriction endonuclease TasI (MBI Fermentas) resulted in fragments of the following sizes: 99 bp + 36 bp + 17 bp + 6 bp (C-allele) and 91 bp + 36 bp + 17 bp + 8 bp + 6 bp (T-allele). The C588T polymorphism is probably identical to a previously described and incorrectly numbered exon 5 variant.12 Allele and genotype frequencies, χ2 tests, power calculations, and the test for Hardy-Weinberg equilibrium were calculated using the SAS computer program (SAS Institute, Cary, NC).19 A 2-tailed type I error rate of 5% was chosen for the analyses.

Reverse Transcriptase (RT) PCR

Reverse transcription PCR was performed using the Titan One Tube RT-PCR-System (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol. The following complementary DNA (cDNA) primers were designed for verification of the wild type GABRG2 sequence: n1024, 5′GCGACACAAGATCCTGGAGGCTTTA, n1025, 5′CCCAGGATAGGACGACAATGAGTGT. Annealing temperatures were optimal at 65°C, and human brain RNA (Clontech, Palo Alto, Calif) was successfully used as template. Single- and nested-PCR attempts, however, failed to amplify the GABRG2 cDNA from total RNA derived from leukocytes.

For the prediction of possible cryptic splice–donor sites within intron 6, the 1998 version of an online splice site predictor program was used (http://www.fruitfly.org).

RESULTS
VERIFICATION OF THE GABRG2 WILD TYPE SEQUENCE

The GABRG2 cDNA sequence (XM_003986.2), which had been deposited into Genbank on April 6, 2001, differed from the previous sequence (XM_003986.1) by the presence of an additional guanine following nucleotide position 770, which is located at the boundary between exons 6 and 7. Compared with the previous GABRG2 sequence, the additional guanine would result in an in-frame stop codon following amino acid position 227 upstream of the first transmembrane domain. Reverse transcriptase PCR amplification of the respective region could not verify the extra guanine. These results were further confirmed by amplification from genomic DNA and direct sequencing of both the exon 6/intron 6 and intron 6/exon 7 boundaries (data not shown).

DETECTION OF A SPLICE–DONOR SITE MUTATION IN A FAMILY WITH CAE AND FC

The coding region and exon/intron boundaries of GABRG2 were screened by single-strand conformation analysis for mutations in genomic DNA samples derived from 135 patients. The DNA of the index patient (II-1) from family 510 showed aberrant electrophoresis patterns indicative of a sequence variation in the respective PCR fragment containing exon 6. Direct sequencing revealed a single base pair exchange at the splice–donor site of intron 6, substituting a thymine with a guanine (IVS6 + 2T→G) (Figure 1). No further mutations were found by screening the entire GABRG2 coding region.

For evaluating the segregation of the IVS6 + 2T→G mutation, exon 6 and the adjacent part of intron 6 were directly sequenced in all available members of family 510. The IVS6 + 2T→G mutation was found in the affected sister and affected father of the index patient but not in the clinically unaffected mother (Figure 1). The mutation was also absent in 176 control chromosomes. These results were confirmed by restriction analysis, which showed an additional MboII restriction site in the carriers of the IVS6 + 2T→G mutation.

The IVS6 + 2T→G mutation destroys the conserved splice site motif (gt) of intron 6, changing it to (gg). Sequence analysis using the splice site predictor program yielded the maximum score of 1.0 for the wild type constitutive splice–donor mutation site of intron 6 but classified the mutated splice site as nonfunctional. Two strong cryptic splice–donor mutation sites were identified at positions IVS6 + 375 (score 0.98) and IVS6 + 758 (score 0.94).

A FREQUENT POLYMORPHISM IN THE GABRG2 GENE IS NOT ASSOCIATED WITH IAE

To further analyze the possible role of the GABRG2 gene in epileptogenesis, we determined the genotype and allele frequencies of the exon 5 C588T polymorphism in the entire sample of 135 IAE patients as well as in 154 controls. Power calculation showed that the employed sample should provide a statistical power of 93.3% to detect a susceptibility factor with a genotypic relative risk of 2.50, assuming a type I error rate of 5% and a prevalence of the risk factor (T-allele) of 30% (SAS version 1988). The genotype distribution did not deviate significantly from that expected according to the Hardy-Weinberg equilibrium. The allele frequencies (χ21= 0.47; P = .49) and genotype frequencies (χ22 = 2.09; P = .35) did not differ significantly between patients with IAE and controls (Table 1).

COMMENT

The IVS6 + 2T→G mutation found in family 510 destroys the 5′-splice site of intron 6, thus preventing the correct cleavage and removal of the intervening sequences from the pre–messenger RNA (mRNA). Since it was not possible to amplify the GABRG2 cDNA from peripheral blood cell templates, the effect of the mutation could not be analyzed directly. However, based on previous studies concerned with splice–donor site mutations (for example, 20-22) some predictions can be made. Most splice–donor site mutations lead to (1) exon skipping, (2) use of cryptic splice sites within the downstream intron, or, if the intron is small, to (3) intron inclusion.20 Because of the size of the GABRG2 intron 6 (approximately 38 kb), the latter is very unlikely. Alternatively, the IVS6 + 2T→G mutation could lead to the use of 1 of the 2 strong cryptic splice sites found at positions IVS6 + 375 and IVS6 + 758. This would result in a truncated protein due to the presence of an in-frame stop codon located at position IVS6 + 65 (Figure 2). However, since almost all of the major cryptic sites that have been found to be activated by mutations are mapped within a 100-bp region from the authentic splice sites, the use of sites located so much further downstream seem to be less likely.21 Exon-skipping is therefore the most plausible mutational mechanism caused by the IVS6 + 2T→G mutation. Skipping of exon 6 would lead to an RNA containing an in-frame stop codon at the joining site of exons 5 and 7 (Figure 2). The predicted protein coded by this aberrantly spliced RNA would be truncated upstream from the first transmembrane domain and would therefore be predicted to be nonfunctional. Thus, we propose that the GABRG2 splice–donor site mutation reported here leads to a nonfunctional allele, which is likely to be the primary cause for epileptic seizures in this family.

The findings reported here suggest that a novel splice mutation of the GABRG2 gene causes a nonfunctional truncation of the GABAA receptor γ-subunit, contributing a major susceptibility effect to the pathogenesis of CAE and FC in a single family. Together with 2 previously identified amino acid exchanges,12,13 this truncation mutation extends the spectrum of GABRG2mutations that confers monogenic effects to the pathogenesis of FC and CAE. Because the screening of 135 patients with IAE did not reveal more than 1 functional mutation and because of the negative results obtained in the association study, it is obvious that GABRG2 is not playing a major role in the pathogenesis of common IAE subtypes.

Back to top
Article Information

Accepted for publication March 25, 2002.

This work was supported by grants Ste769/2-1 (Dr Steinlein), Sa434/2-2 (Dr Sander), and For423 (Dr Heils) from the Deutsche Forschungsgemeinschaft, Bonn, and grants from the German Bundesministerium fuer Bildung und Forschung, Berlin, and BONFOR, Bonn (Dr Heils). Dr Haug is also supported by the German Volkswagenstiftung, Hanover, Germany.

Author contributions: Study concept and design (Mss Kananura, Gu, and Hallmann, and Drs Haug, Sander, Rebstock, Heils, and Steinlein); acquisition of data (Mss Kananura, Gu, and Hallmann, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein); analysis and interpretation of data (Mss Kananura, Gu, and Hallman, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein); drafting of the manuscript (Mss Kananura, Gu, and Hallmann, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein); critical revision of the manuscript for important intellectual content (Mss Kananura, Gu, and Hallmann, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein); statistical expertise (Ms Kananura); and administrative, technical, and material support (Mss Kananura, Gu, and Hallman, and Drs Haug, Sander, Runge, Rebstock, Heils, and Steinlein).

Corresponding author and reprints: Ortrud K. Steinlein, MD, Institute of Human Genetics, University Hospital Bonn, Wilhelmstr 31, D-53111 Bonn, Germany (e-mail: ortrud.steinlein@ukb.uni-bonn.de).

References
1.
Duncan  JS Idiopathic generalized epilepsies with typical absences. J Neurol.1997;244:403-411.
2.
Schuman  SHMiller  LJ Febrile convulsions in families: findings in an epidemiologic survey. Clin Pediatr (Phila).1966;5:604-608.
3.
Van der Berg  BJYerushalmy  J Studies on convulsive disorders in young children, I: incidence of febrile and nonfebrile convulsions by age and other factors. Pediatr Res.1969;3:298-304.
4.
Nelson  KBEllenberg  JH Prognosis in children with febrile seizures. Pediatrics.1978;61:720-727.
5.
Berkovic  SFScheffer  IE Febrile seizures: genetics and relationship to other epilepsy syndromes. Curr Opin Neurol.1998;11:129-134.
6.
Italian League Against Epilepsy Genetic Collaborative Group Concordance of clinical forms of epilepsy in families with several affected members. Epilepsia.1993;34:819-826.
7.
Scheffer  IEBerkovic  SF Generalized epilepsy with febrile seizures plus: a genetic disorder with heterogeneous clinical phenotypes. Brain.1997;120:479-490.
8.
Singh  RScheffer  IECrossland  KBerkovic  SF Generalized epilepsy with febrile seizures plus: a common childhood-onset genetic epilepsy syndrome. Ann Neurol.1999;45:75-81.
9.
Wallace  RHWang  DWSingh  R  et al Febrile seizures and generalized epilepsy associated with a mutation in the Na+-channel beta1 subunit gene SCN1B. Nat Genet.1998;19:366-370.
10.
Escayg  AMacDonald  BTMeisler  MH  et al Mutations of SCN1A, encoding a neuronal sodium channel, in two families with GEFS+2. Nat Genet.2000;24:343-345.
11.
Sugawara  TTsurubuchi  YAgarwala  KL  et al A missense mutation of the Na+ channel alpha II subunit gene Na(v)1.2 in a patient with febrile and afebrile seizures causes channel dysfunction. Proc Natl Acad Sci U S A.2001;98:6384-6389.
12.
Baulac  SHuberfeld  GGourfinkel-An  I  et al First genetic evidence of GABA(A) receptor dysfunction in epilepsy: a mutation in the gamma2-subunit gene. Nat Genet.2001;28:46-48.
13.
Wallace  RHMarini  CPetrou  S  et al Mutant GABA(A) receptor gamma2-subunit in childhood absence epilepsy and febrile seizures. Nat Genet.2001;28:49-52.
14.
Olsen  RWAvoli  M GABA and epileptogenesis. Epilepsia.1997;38:399-407.
15.
Snodgrass  SR GABA and epilepsy: their complex relationship and the evolution of our understanding. J Child Neurol.1992;7:77-86.
16.
Gadea  ALopez-Colome  AM Glial transporters for glutamate, glycine, and GABA, II: GABA transporters. J Neurosci Res.2001;63:461-468.
17.
Not Available Commission on Classification and Terminology of the International League Against Epilepsy proposal for revised classification of epilepsies and epileptic syndromes. Epilepsia.1998;30:389-399.
18.
Miller  SADykes  DPlesky  HF A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res.1988;16:1215.
19.
Not Available SAS/STAT User's Guide, Release 6.03 Edition.  Cary, NC: SAS Institute; 1988.
20.
Talerico  MBerget  SM Effect of 5′ splice site mutations on splicing of the preceding intron. Mol Cell Biol.1990;10:6299-6305.
21.
Nakai  KSakamoto  H Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene.1994;141:171-177.
22.
Anderson  SLColi  RDaly  IW  et al Familial dysautonomia is caused by mutations of the IKAP gene. Am J Hum Genet.2001;68:753-758.
23.
Whiting  PMcKernan  RMIversen  LL Another mechanism for creating diversity in gamma-aminobutyrate type A receptors: RNA splicing directs expression of two forms of gamma 2 phosphorylation site. Proc Natl Acad Sci U S A.1990;87:9966-9970.
×