[Skip to Content]
Access to paid content on this site is currently suspended due to excessive activity being detected from your IP address 54.161.216.242. Please contact the publisher to request reinstatement.
Sign In
Individual Sign In
Create an Account
Institutional Sign In
OpenAthens Shibboleth
[Skip to Content Landing]
Observation
April 2008

Disruption of Sodium Bicarbonate Transporter SLC4A10 in a Patient With Complex Partial Epilepsy and Mental Retardation

Author Affiliations

Author Affiliations: Departments of Neurology (Drs Gurnett and Zempel), Pediatrics (Dr Gurnett), and Genetics (Ms Veile and Drs Lovett and Bowcock), Washington University School of Medicine, St Louis, Missouri; and Department of Neurology, Medical College of Wisconsin, Milwaukee (Dr Blackburn).

Arch Neurol. 2008;65(4):550-553. doi:10.1001/archneur.65.4.550
Abstract

Objective  To determine gene(s) disrupted in a patient with partial frontal lobe epilepsy and cognitive impairment with concomitant de novo balanced chromosomal translocation t(2;13)(q24;q31).

Design  Fluorescence in situ hybridization and array comparative genomic hybridization were used to map the locations of chromosomal translocation breakpoints.

Results  SLC4A10 (OMIM 605556), a sodium bicarbonate transporter gene with high expression in the cerebral cortex and hippocampus, was disrupted by the translocation breakpoint on chromosome 2q24. The breakpoint on chromosome 13q31 was in a 1-megabase (Mb)–gene desert. Genomewide array comparative genomic hybridization confirmed the absence of additional chromosomal abnormalities.

Conclusion  SLC4A10 is the third SLC4 base transporter family member to be implicated in human cognition and epilepsy.

Neuronal excitability is affected by alteration of acid-base homeostasis in the central nervous system.1 Hyperventilation, resulting in respiratory alkalosis, increases the frequency of generalized epileptiform discharges and absence seizures. Fever-induced respiratory alkalosis may also trigger seizures, an effect that can be modeled by direct application of sodium bicarbonate to the brain.2 Further evidence of the importance of acid-base balance in neuronal excitability is demonstrated by the use of carbonic anhydrase inhibitors to treat epilepsy. Changes in pH that may contribute to the epileptic phenotype include effects on ion channel activity, transporter function, and neurotransmission.3,4

Despite the importance of pH regulation in central nervous system excitability, few genes involved in these pathways have been implicated in epilepsy. Loss of sodium hydrogen exchanger 1 (NHE1 or Slc9a1) results in slow-wave epilepsy in mice.5 Although cells lacking NHE1 were more excitable, intracellular pH was unaffected and sodium channel upregulation was proposed as a possible mechanism of increased excitability.6 However, mutations have not yet been identified in SLC9A1 (OMIM 107310) in humans with epilepsy, nor in any other gene responsible for brain proton or sodium bicarbonate transport.

This article describes, to our knowledge, the first patient with epilepsy and cognitive impairment with disruption of SLC4A10, a gene encoding an electroneutral sodium bicarbonate exchanger. The findings from this study suggest that normal SLC4A10 expression is critical for human cognitive function and neuronal excitability.

METHODS
PATIENT

A 13-year-old girl with moderate mental retardation and partial complex epilepsy was examined. She weighed 4710 g at birth following an uncomplicated pregnancy and delivery. She did not walk until 30 months and had delayed speech. No dysmorphic features were noted. Growth was normal. There was no family history of seizures, mental retardation, or autism. The patient's first seizure occurred at age 7 years. Seizures were brief (<60 seconds) and consisted of right arm movements with head and eye deviation and alteration of consciousness. Seizures were well controlled with zonisamide therapy but had not responded to lamotrigine therapy.

An electroencephalogram demonstrated slowing of the posterior dominant rhythm, as well as left frontal spike discharges (Figure 1A). Brain magnetic resonance imaging was normal. As a part of the workup for developmental delay, karyotyping was performed showing a de novo balanced translocation t(2;13)(q24;q31).

Figure 1.
A, Electroencephalogram showing left frontal spike discharges. B, Neuropsychological test results using the Stanford-Binet Intelligence Scales showing declines in the patient between ages 5 (1999) and 9 (2003) years. EKG indicates electrocardiogram.

A, Electroencephalogram showing left frontal spike discharges. B, Neuropsychological test results using the Stanford-Binet Intelligence Scales7 showing declines in the patient between ages 5 (1999) and 9 (2003) years. EKG indicates electrocardiogram.

Neuropsychological testing with the Stanford-Binet Intelligence Scales7 revealed deficits in all areas (Figure 1B). At age 6 years, the patient experienced a significant slowing in the rate of cognitive development, which was reflected by declines in intelligence (z scores). Result of testing using the Childhood Autism Rating Scale8 was in the nonautistic category (raw score, 18.5).

CONSENT AND SAMPLE COLLECTION

Research was approved by the Washington University Human Subjects Committee, St Louis, Missouri. After obtaining informed consent, DNA and RNA were extracted from lymphoblastoid cell lines using standard methods.

FLUORESCENCE IN SITU HYBRIDIZATION

Bacterial artificial chromosome (BAC) clones flanking the presumed translocation breakpoints were obtained from BACPAC Resources (Children's Hospital Oakland Research Institute, Oakland, California) and used as probes for fluorescence in situ hybridization (FISH) as described elsewhere.9

COMPARATIVE GENOMIC HYBRIDIZATION

Patient DNA was evaluated by whole genome array comparative genomic hybridization (385 000 probes) (NimbleGen Systems, Inc, Madison, Wisconsin) to detect DNA copy number variations. Data were analyzed with SignalMap browser (NimbleGen Systems, Inc). Copy number variations were screened against databases of known variants.

REAL-TIME QUANTITATIVE POLYMERASE CHAIN REACTION

Primers designed to SLC4A10 RNA (GCTGCTGCCTACGAGAAATG and CTGTGTTTATGACCACGATGC) were used for amplification with a cycler (model 7000; Applied Biosystems, Foster City, California) using SYBR Green dye (Applied Biosystems). Beta-actin was used as the reference. Control RNA was obtained from CEPH lymphoblastoid cell lines. The delta-delta Ct method was used for quantification.

RESULTS
FISH MAPPING OF TRANSLOCATION BREAKPOINTS

FISH was performed to localize translocation breakpoints using a series of bacterial artificial chromosome (BAC) clones near the cytogenetically detected breakpoints on chromosomes 2q and 13q. On chromosome 2q, RP11-757J24 was shown to cross the breakpoint (Figure 2A). Further mapping narrowed the breakpoint to a 48-kilobase (kb) region between SLC4A10 exons 2 and 3, near, but not overlapping, the SLC4A10 deletion detected in a pair of identical autistic twins (Figure 2B).10 A cluster of sodium channels relevant to human epilepsy (SCN1, SCN7, and SCN9) are located more than 4 Mb distal to the breakpoint (Figure 3).

Figure 2.
A, Fluorescence in situ hybridization demonstrating that bacterial artificial chromosome (BAC) clone RP11-757J24 crosses the translocation breakpoint on chromosome 2q24. Signal is detected on normal chromosome 2 and both derivative chromosomes [t(2:13)]. B, Diagram shows SLC4A10 transcript, location of deletion in twins with autism, and location of translocation breakpoint in our patient described herein.

A, Fluorescence in situ hybridization demonstrating that bacterial artificial chromosome (BAC) clone RP11-757J24 crosses the translocation breakpoint on chromosome 2q24. Signal is detected on normal chromosome 2 and both derivative chromosomes [t(2:13)]. B, Diagram shows SLC4A10 transcript, location of deletion in twins with autism,10 and location of translocation breakpoint in our patient described herein.

Figure 3.
Comparative genomic hybridization microarray data showing the absence of chromosomal copy number changes (deletions or insertions) at or near the breakpoints on chromosome 2q (A) or 13q (B) in our patient. The x-axis indicates physical location along the chromosomes 2q or 13q (in megabases [Mb]) and y-axis indicates log2 ratio of patient to reference DNA hybridization signal.

Comparative genomic hybridization microarray data showing the absence of chromosomal copy number changes (deletions or insertions) at or near the breakpoints on chromosome 2q (A) or 13q (B) in our patient. The x-axis indicates physical location along the chromosomes 2q or 13q (in megabases [Mb]) and y-axis indicates log2 ratio of patient to reference DNA hybridization signal.

On chromosome 13q, the breakpoint was narrowed to a 422-kb region within a 1-megabase (Mb)–gene desert by identifying BAC clones located above (RP11-206K5) and below (RP11-19D22) the breakpoint (data not shown). The nearest gene proximal to the breakpoint on chromosome 13q is LMO7, located at least 200 kb from the breakpoint (Figure 3). KCTD12 is located at least 400 kb distal to the breakpoint on chromosome 13q.

ARRAY COMPARATIVE GENOMIC HYBRIDIZATION

Because recent evidence suggests that additional genomic imbalances may occur in patients with apparent balanced chromosomal translocations,11 DNA copy number changes were evaluated using genomewide comparative genomic hybridization. Although several known and nondisease related copy number polymorphisms were detected on other chromosomes (data not shown), no deletions were detected near the breakpoints on chromosome 2 or 13 (Figure 3) nor anywhere else in the patient's genome.

EVALUATION OF SLC4A10 TRANSCRIPTS

Because brain tissue was unavailable from this patient, immortalized lymphoblast RNA was evaluated. SLC4A10 is minimally expressed in lymphoblasts as evidenced by a lack of expression by either Northern or Western blot analysis (data not shown). Quantitative real-time polymerase chain reaction demonstrated a 48% reduction in SLC4A10 transcript in the patient's lymphoblasts compared with reference gene beta-actin when normalized to a calibrator consisting of control lymphoblasts RNA.

COMMENT

To our knowledge, this is the first article to describe a role for the sodium bicarbonate transporter, SLC4A10, in epilepsy and human cognition. SLC4A10 is a member of the SL4 family of base transporters that consists of 10 family members.12SLC4A10 is present in multiple tissues but is highly expressed in the cerebral cortex and hippocampus, 2 regions commonly implicated in epilepsy. To date, 5 members of the SLC4 family of base transporters have been implicated in human disease (Table). SLC4A3 polymorphisms are associated with generalized epilepsy in humans,14 and mice with targeted disruption of this gene have reduced seizure thresholds.17

Table. 
SLC4 Base Transporters Associated With Human Disease
SLC4 Base Transporters Associated With Human Disease

Although chromosomal translocations may have long-distance effects on genes due to disruption of regulatory sequences or chromatin structure, there are few examples of effects occurring from distances greater than 1 Mb.18 Therefore, a cluster of sodium channel genes relevant to human epilepsy (SCN1, SCN7, and SCN9) that is located more than 4 Mb distal to the chromosomal 2 breakpoint (Figure 3) is unlikely to be affected by this patient's translocation.

A chromosomal deletion involving SLC4A10 was previously detected in both members of a pair of identical twins from a large cohort of patients with autism screened for the presence of DNA copy number mutations.10 However, these patients were not described in detail, and it is unknown whether these twins had cognitive dysfunction or epilepsy. Many genetic diseases, including fragile X and tuberous sclerosis, give rise to a spectrum of cognitive phenotypes that may manifest as autism, mental retardation, or both,19,20 reflecting the polygenic inheritance of these traits. The patient described herein had an unusual decline in cognitive function despite having seizures that were well controlled with a single medication. Additional patients with mutations or deletions of SLC4A10 will need to be identified to determine the frequency of cognitive deficits, cognitive decline, autism, and epilepsy.

Disruption of SLC4A10 occurring through either a chromosomal translocation or deletion (as described in the identical twins concordant for autism described in Sebat et al10) may result in disease through haploinsufficiency. Haploinsufficiency of several gene products critical to brain function results in epilepsy, including the sodium channel gene SCN1A and the glucose transporter GLUT-1.21 Although autosomal dominant hereditary spherocytosis resulting from SLC4A1 mutations may result from haploinsufficiency, some mutations may cause disease via gain of function effects through misfolding and heterodimer formation.22 However, SLC4A10 is not expressed sufficiently in lymphoblasts to determine whether any aberrant truncated forms are expressed. Phenotypes resulting from mouse SLC4A10 gene knockouts have not yet been described but may allow the mechanism by which sodium bicarbonate transporter disruption leads to epilepsy and cognitive dysfunction to be elucidated.

Back to top
Article Information

Correspondence: Christina A. Gurnett, MD, PhD, Department of Neurology, Washington University School of Medicine, Campus Box 8111, 660 S Euclid Ave, St Louis, MO 63110 (gurnettc@neuro.wustl.edu).

Accepted for Publication: October 18, 2007.

Author Contributions:Study concept and design: Gurnett and Bowcock. Acquisition of data: Gurnett, Veile, Blackburn, Lovett, and Bowcock. Analysis and interpretation of data: Gurnett, Veile, Zempel, Blackburn, Lovett, and Bowcock. Drafting of the manuscript: Gurnett and Veile. Critical revision of the manuscript for important intellectual content: Gurnett, Zempel, Blackburn, Lovett, and Bowcock. Obtained funding: Gurnett. Administrative, technical, and material support: Gurnett, Veile, Zempel, and Lovett. Study supervision: Bowcock.

Financial Disclosure: None reported.

Funding/Support: This study was supported by grant NS01690 from the National Institute of Neurological Disorders and Stroke, National Institutes of Health (Dr Gurnett), an Early Career Physician Scientist Award from the American Epilepsy Society (Dr Gurnett), and the Children's Discovery Institute (Dr Gurnett).

Additional Contributions: Jeppe Praetorius, MD, PhD, provided a gift of the SLC4A10 antibody.

References
1.
Ransom  BR Glial modulation of neural excitability mediated by extracellular pH: a hypothesis. Prog Brain Res 1992;9437- 46
PubMed
2.
Schuchmann  SSchmitz  DRivera  C  et al.  Experimental febrile seizures are precipitated by a hyperthermia-induced respiratory alkalosis. Nat Med 2006;12 (7) 817- 823
PubMedArticle
3.
Beck  H Plasticity of antiepileptic drug targets. Epilepsia 2007;48 ((suppl 1)) 14- 18
PubMedArticle
4.
Chesler  M Regulation and modulation of pH in the brain. Physiol Rev 2003;83 (4) 1183- 1221
PubMed
5.
Cox  GALutz  CMYang  CL  et al.  Sodium/hydrogen exchanger gene defect in slow-wave epilepsy mutant mice [published correction appears in Cell. 1997;91(6):861]. Cell 1997;91 (1) 139- 148
PubMedArticle
6.
Gu  XQYao  HHaddad  GG Increased neuronal excitability and seizures in the Na(+)/H(+) exchanger null mutant mouse. Am J Physiol Cell Physiol 2001;281 (2) C496- C503
PubMed
7.
Thorndike  RLHagen  EPSattler  JM Stanford-Binet Intelligence Scale. 4th ed. Rolling Meadows, IL Riverside Publishing Co1999;
8.
Schopler  EReichler  RJDeVellis  RFDaly  K Toward objective classification of childhood autism: Childhood Autism Rating Scale (CARS). J Autism Dev Disord 1980;10 (1) 91- 103
PubMedArticle
9.
Bashiardes  SVeile  RAllen  M  et al.  SNTG1, the gene encoding gamma1-syntrophin: a candidate gene for idiopathic scoliosis. Hum Genet 2004;115 (1) 81- 89
PubMedArticle
10.
Sebat  JLakshmi  BMalhotra  D  et al.  Strong association of de novo copy number mutations with autism. Science 2007;316 (5823) 445- 449
PubMedArticle
11.
Gribble  SMPrigmore  EBurford  DC  et al.  The complex nature of constitutional de novo apparently balanced translocations in patients presenting with abnormal phenotypes. J Med Genet 2005;42 (1) 8- 16
PubMedArticle
12.
Pushkin  AKurtz  I SLC4 base (HCO3-, CO3 2-) transporters: classification, function, structure, genetic diseases, and knockout models. Am J Physiol Renal Physiol 2006;290 (3) F580- F599
PubMedArticle
13.
Schofield  AEReardon  DMTanner  MJ Defective anion transport activity of the abnormal band 3 in hereditary ovalocytic red blood cells. Nature 1992;355 (6363) 836- 838
PubMedArticle
14.
Sander  TToliat  MRHeils  A  et al.  Association of the 867Asp variant of the human anion exchanger 3 gene with common subtypes of idiopathic generalized epilepsy. Epilepsy Res 2002;51 (3) 249- 255
PubMedArticle
15.
Igarashi  TInatomi  JSekine  T  et al.  Mutations in SLC4A4 cause permanent isolated proximal renal tubular acidosis with ocular abnormalities. Nat Genet 1999;23 (3) 264- 266
PubMedArticle
16.
Barkley  RAChakravarti  ACooper  RS  et al. Family Blood Pressure Program, Positional identification of hypertension susceptibility genes on chromosome 2. Hypertension 2004;43 (2) 477- 482
PubMedArticle
17.
Hentschke  MWiemann  MHentschke  S  et al.  Mice with a targeted disruption of the Cl-/HCO3- exchanger AE3 display a reduced seizure threshold. Mol Cell Biol 2006;26 (1) 182- 191
PubMedArticle
18.
Kleinjan  DAvan Heyningen  V Long-range control of gene expression: emerging mechanisms and disruption in disease. Am J Hum Genet 2005;76 (1) 8- 32
PubMedArticle
19.
Hatton  DDSideris  JSkinner  M  et al.  Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP. Am J Med Genet A 2006;140 (17) 1804- 1813
PubMedArticle
20.
Dabora  SLJozwiak  SFranz  DN  et al.  Mutational analysis in a cohort of 224 tuberous sclerosis patients indicates increased severity of TSC2, compared with TSC1, disease in multiple organs. Am J Hum Genet 2001;68 (1) 64- 80
PubMedArticle
21.
Seidner  GAlvarez  MGYeh  JI  et al.  GLUT-1 deficiency syndrome caused by haploinsufficiency of the blood-brain barrier hexose carrier. Nat Genet 1998;18 (2) 188- 191
PubMedArticle
22.
Bruce  LJRobinson  HCGuizouarn  H  et al.  Monovalent cation leaks in human red cells caused by single amino-acid substitutions in the transport domain of the band 3 chloride-bicarbonate exchanger, AE1. Nat Genet 2005;37 (11) 1258- 1263
PubMedArticle
×