[Skip to Content]
Sign In
Individual Sign In
Create an Account
Institutional Sign In
OpenAthens Shibboleth
[Skip to Content Landing]
Views 369
Citations 0
Research Letter
July 2016

Expression of Circulating Muscarinic Receptors in Infants With Severe Idiopathic Life-Threatening Events

Author Affiliations
  • 1Unit of Cardiopediatrics, Hautepierre University Hospital, Strasbourg, France
  • 2Laboratory of Neurobiology and Cardiovascular Pharmacology, Federation of Translational Medicine, University of Strasbourg, Strasbourg, France
  • 3Center of Clinical Investigation, University Hospitals of Strasbourg, Strasbourg, France
JAMA Pediatr. 2016;170(7):707-708. doi:10.1001/jamapediatrics.2015.4762

About half of the apparent life-threatening events (ALTEs) that occur among infants remain unexplained and are called idiopathic.1 Yet there is no biomarker associated with idiopathic ALTEs. Although the connection between ALTEs and sudden infant death syndrome (SIDS) remains controversial, the cholinergic system has been investigated in the pathogenesis of both.24 We investigate the M2 muscarinic receptors’ expression in the blood samples of infants who experienced severe ALTEs.

Methods

We prospectively enrolled 17 consecutive, previously healthy infants (age, <1 year) who had a first episode of severe ALTE, which is defined as a sudden episode that is characterized by some combination of apnea, color change, marked change in muscle tone, choking, or gagging.5 Severity was defined as direct admission to an intensive care unit shortly after the event. Blood samples for M2 analysis were collected at admission, and the diagnostic workup started after admission. Cases with no specific diagnosis were classified as idiopathic.5,6 After the diagnostic procedure was performed for all 17 infants, it was determined that 5 had idiopathic ALTEs and 12 had ALTEs of known etiology. A third group consisted of 9 healthy control infants who had no family history of ALTE/SIDS. The study was conducted in accordance with the national regulations on medical research, and written informed consent was obtained from the infants’ parents/guardians.

Whole-blood samples were collected in PaxGene Blood RNA Tubes (Qiagen/BD). Total RNA was extracted with the PaxGene RNA kit (Qiagen); 200 ng of total RNA were reverse transcribed into complementary DNA using the iScript cDNA Synthesis kit (Biorad). M2 gene expression was measured by quantitative real-time polymerase chain reaction using a specific primer for the M2 receptor gene CHRM2 (F: AAGACCCCGTTTCTCCAAGT; R: GAGGCAACAGCACTGACTGA). The rabbit 18S housekeeping gene (F: CCTGCGGCTTAATTTGACTC; R: ATGCCAGAGTCTCGTTCGTT) was used for normalization, and M2 levels are expressed as the M2:18S ratio. The samples were analyzed following a blinded procedure. Statistical significance was set at P = .05.

Results

The baseline characteristics of the groups of infants and the specific diagnoses for ALTEs of known cause are summarized in the Table. The median M2 expression was not significantly different between the 9 healthy control infants (0.19 [range, 0.02-1.30]) and the 12 infants who experienced ALTEs of known cause (0.13 [range, 0.01-0.65]). In contrast, M2 expression was significantly higher in the 5 infants who experienced idiopathic ALTEs compared with other 2 groups of infants (11.73 [range, 3.32-16.35]) (P < .001) (Figure).

Table.  
Summary of Baseline Dataa
Summary of Baseline Dataa
Figure.
Muscarinic Receptor (M2) Expression in 3 Groups of Infants
Muscarinic Receptor (M2) Expression in 3 Groups of Infants

Each symbol represents 1 individual value. The solid lines represent the median values of the groups; the dotted horizontal line represents the highest control value. ALTEs indicates apparent life-threatening events.

aFor nonparametric testing, with adjustment for multiple comparisons.

Discussion

In this study, the average M2 expression in the 5 infants who experienced idiopathic ALTEs was 20 to 50 times higher than the other 2 groups of infants (ie, the 12 infants who experienced ALTEs of known etiology and the 9 healthy control infants), with no overlapping. This finding appears to be specific and is not likely to reflect an acute-phase effect because both the infants who experienced idiopathic ALTEs and the infants who experienced ALTEs of known etiology were severe cases. It also seems unlikely that the receptors’ upregulation is driven by certain diseases or treatments because all the values of M2 expression in the group of infants who experienced ALTEs of known cause were consistently low and were no different than the values found in the group of healthy control infants who did not have any pathologies or treatments. These preliminary observations imply that idiopathic ALTEs and ALTEs of known etiology may have different underlying mechanistic pathways.

Another study has reported alterations in cerebral muscarinic receptors in infants who died of SIDS.3 Although ALTEs are generally not considered to be related to SIDS, this is based on studies that have not necessarily distinguished groups by illness severity or lack of a diagnosis. The present data, together with our previous findings of cardiac muscarinic receptors in SIDS, suggest that parasympathetic overactivity may be a common vulnerability between SIDS and severe, idiopathic ALTEs.4 This is also in line with recent evidence suggesting that both syndromes could be related.6

A limitation of our study is the small sample size, but severe idiopathic ALTE is a rare condition. Larger studies are needed to assess the potential clinical implications of this novel, easily detectable, circulating marker, to understand the mechanisms and develop preventative strategies.

Back to top
Article Information

Corresponding Author: Angelo Livolsi, MD, Unit of Cardiopediatrics, Hautepierre University Hospital, Avenue Molière, 67098 Strasbourg, Alsace, France (angelo.livolsi@chru-strasbourg.fr).

Published Online: May 9, 2016. doi:10.1001/jamapediatrics.2015.4762.

Author Contributions: Drs Adamopoulos and Livolsi had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis.

Study concept and design: Adamopoulos, Bousquet, Livolsi.

Acquisition, analysis, or interpretation of data: All authors.

Drafting of the manuscript: Adamopoulos, Livolsi.

Critical revision of the manuscript for important intellectual content: All authors.

Statistical analysis: Adamopoulos, Livolsi.

Obtained funding: Bousquet, Livolsi.

Administrative, technical, or material support: Greney, Beutelstetter.

Study supervision: Bousquet, Livolsi.

Conflict of Interest Disclosures: None reported.

Funding/Support: The study was funded by the French Society of Cardiology.

Role of the Funder/Sponsor: The funding source had no role in the design and conduct of the study; collection, management, analysis, or interpretation of the data; preparation, review, or approval of the manuscript; and decision to submit the manuscript for publication.

References
1.
Kiechl-Kohlendorfer  U, Hof  D, Peglow  UP, Traweger-Ravanelli  B, Kiechl  S.  Epidemiology of apparent life threatening events.  Arch Dis Child. 2005;90(3):297-300.PubMedGoogle ScholarCrossref
2.
Dick  A, Ford  R.  Cholinergic and oxidative stress mechanisms in sudden infant death syndrome.  Acta Paediatr. 2009;98(11):1768-1775.PubMedGoogle ScholarCrossref
3.
Kinney  HC, Filiano  JJ, Sleeper  LA, Mandell  F, Valdes-Dapena  M, White  WF.  Decreased muscarinic receptor binding in the arcuate nucleus in sudden infant death syndrome.  Science. 1995;269(5229):1446-1450.PubMedGoogle ScholarCrossref
4.
Livolsi  A, Niederhoffer  N, Dali-Youcef  N,  et al.  Cardiac muscarinic receptor overexpression in sudden infant death syndrome.  PLoS One. 2010;5(3):e9464.PubMedGoogle ScholarCrossref
5.
Kahn  A; European Society for the Study and Prevention of Infant Death.  Recommended clinical evaluation of infants with an apparent life-threatening event: consensus document of the European Society for the Study and Prevention of Infant Death, 2003.  Eur J Pediatr. 2004;163(2):108-115.PubMedGoogle ScholarCrossref
6.
Filonzi  L, Magnani  C, Nosetti  L,  et al.  Serotonin transporter role in identifying similarities between SIDS and idiopathic ALTE.  Pediatrics. 2012;130(1):e138-e144.PubMedGoogle ScholarCrossref
×